Bio


Mary Beth Mudgett, the Stanford Friends University Fellow in Undergraduate Education, is the Senior Associate Dean for the Natural Sciences in the School of Humanities & Sciences. She received her doctorate in biochemistry at University of California, Los Angeles and has been a professor in Stanford's Department of Biology since 2002. Her research group studies plant-pathogen interactions, focusing on the biochemical mechanisms that pathogens use to manipulate the plant immune system resulting in disease outbreaks. As president of the International Society for Plant-Microbe Interactions, Mudgett launched a series of virtual symposia and platforms to enable networking on a global scale, while creating an inclusive environment to hear from the society’s diverse stakeholders. Mudgett is also passionate about teaching and mentorship. She has launched new initiatives within biology to embrace different learning styles and enhance the student experience in the classroom. She also leads efforts to reshape introductory science and math courses to better support students with different levels of preparation for success in STEM majors. Mudgett partners on a school initiative to provide teaching mentorship support for junior faculty and their mentors to enhance best practices across the curricula. As co-chair of Stanford’s Academic Continuity Group, Mudgett helped the university blaze a path through the thicket of teaching challenges posed by the pandemic. She helped to solve problems involving online learning and curriculum development and to create the infrastructure and support needed for faculty, staff, and students to safely return to in-person instruction. In addition, she directed the Dean’s Fellows Program, which provided teaching and research opportunities for graduate students completing their degrees and facing a job market made challenging by the pandemic. In her current role, she is dedicated to champion the core missions in research, teaching, and mentoring within the natural science cluster and broader communities.

Academic Appointments


Administrative Appointments


  • Senior Associate Dean of Natural Sciences, School of Humanities & Sciences, Stanford University (2022 - Present)
  • Senior Associate Dean, Educational Initiatives, School of Humanities & Sciences, Stanford University (2019 - 2022)
  • Adjunct Staff Scientist, Department of Plant Biology, Carnegie Institute of Science (2016 - Present)
  • Professor, Department of Biology, Stanford University (2015 - Present)
  • Associate Professor, Department of Biology, Stanford University (2010 - 2015)
  • Assistant Professor, Department of Biology, Stanford University (2002 - 2009)

Honors & Awards


  • Bass Fellow, Stanford Friends University Fellow in Undergraduate Education, Stanford University (2018-2022)
  • Dean's Award for Distinguished Teaching, School of H&S, Stanford University (2017)
  • Phi Beta Kappa Teaching Excellence Prize, PBK Northern Chapter (2017)
  • Phi Beta Kappa Teaching Prize, Stanford University (2016)
  • Excellence in Diversity, Bioscience Faculty Excellence Award, School of Medicine, Stanford University (2014)
  • VPUE Faculty Scholar, Stanford University (2013-2014)
  • Chambers Fellow, Stanford University (2011-2014)
  • Teacher of the Year, Associated Students of Stanford University (2008)
  • Hellman Faculty Scholar, Stanford University (2005-2006)
  • Terman Fellow, Stanford University (2004-2010)
  • National Research Service Award, National Institute of Health (1997-1999)
  • Graduate Research Achievement Award, University of California, Los Angeles (1992)
  • Graduate Teaching Assistant Award, University of California, Los Angeles (1990)

Boards, Advisory Committees, Professional Organizations


  • Advisor, University Accreditation Advisory Committee, Stanford University (2022 - Present)
  • Chair, Execute Advisory Committee for Hopkins Marine Station, Stanford University (2021 - Present)
  • Member, Faculty Senate, Stanford University (2021 - Present)
  • Chair, Center for Teaching & Learning Director Search, Stanford University (2021 - 2021)
  • Co-Chair, Summer Program Committee, Stanford University (2020 - Present)
  • Member, IDEAL Education Committee, Stanford University (2020 - Present)
  • Co-lead, Academic Continuity, Pandemic Response, Stanford University (2020 - 2022)
  • Member, Policy Group for Pandemic Response, Stanford University (2020 - 2022)
  • Advisor, VPUE Undergraduate Advisory Council, Stanford University (2019 - Present)
  • President, International Society for Molecular Plant-Microbe Interactions (2019 - 2022)
  • Member, Committee on Committees, Stanford Academic Council, Stanford University (2019 - 2020)
  • Member, Search Committee for Vice Provost of Undergraduate Education, Stanford University (2019 - 2020)
  • Member, Faculty Senate, Stanford University (2018 - 2020)
  • Member, First Year Experience Design Team, Long-range Planning, Stanford University (2018 - 2019)
  • Member, Steering Committee, Stanford Academic Council, Stanford University (2018 - 2019)
  • Chair, Natural Sciences Long-Range Planning, School of Humanities & Sciences, Stanford University (2017 - 2017)
  • Member, Committee on Review of Undergraduate Majors (C-RUM), Stanford University (2016 - 2019)
  • Reviewer, Biophysics IDP Graduate Program, School of Medicine, Stanford University (2016 - 2016)
  • Reviewer, Immunology IDP Graduate Program, School of Medicine, Stanford University (2016 - 2016)
  • Advisor, Advisory Committee for NIH IRACDA Postdoctoral Program, Stanford University (2015 - 2020)
  • Director of Graduate Studies, Department of Biology, Stanford University (2015 - 2019)
  • Member, Committee on Graduate Admissions and Policy, Bioscience Program, Stanford University (2014 - 2019)
  • Member, Executive Committee, Biology Department, Stanford University (2014 - 2019)
  • Fellow, ChEM-H: Chemistry, Engineering & Medicine for Human Health, Stanford University (2013 - Present)
  • Chair, Bioscience Diversity Advisory Council (BDAC), School of Medicine, Stanford University (2013 - 2020)
  • Member, Steering Committee, NIH Biotech Predoctoral Training Program, Bioengineering, Stanford University (2013 - 2020)
  • Member, Postdoctoral Mentoring Initiative Task Force, Stanford Biosciences, Stanford University (2013 - 2014)
  • Member, Sustainable Funding Model Working Group, Stanford Biosciences, Stanford University (2013 - 2014)
  • Participant, Vision & Change in Undergraduate Biology Education, National Science Foundation & AAAS (2013 - 2013)
  • Board Member, International Society for Molecular Plant-Microbe Interactions (2012 - Present)
  • Member, Biology Graduate Studies Committee, Stanford University (2011 - 2019)
  • Chair of Biology Graduate Admissions & Recruiting, Stanford University (2011 - 2014)
  • Member, Faculty Senate, Stanford University (2011 - 2014)
  • Editor, Frontiers in Plant-Microbe Interactions, Frontiers Journal (2010 - 2014)
  • Specialty Chief Editor, Frontiers in Plant-Microbe Interactions, Frontiers Journal (2010 - 2014)
  • Member, Committee on Research (C-Res), Stanford University (2010 - 2013)
  • Chair & Board Member, Pierce's Disease/Glassy Wing Sharp Shooter Research Advisory Board, California Department of Food & Agriculture (2009 - 2014)
  • Senior Editor, Molecular Plant Pathology, British Society for Plant Pathology (2009 - 2011)
  • Advisor, Pre-Major Undergraduate Advisor, Stanford University (2007 - 2018)
  • Advisor, Graduate Program Review, Department of Molecular & Cell Biology, Oregon State University (2006 - 2006)
  • Associate Editor, Molecular Plant-Microbe Interactions, International Society for Plant-Microbe Interactions (2004 - 2005)
  • Advisor, Annual Review of Plant Biology, Annual Reviews (2004 - 2004)
  • Member, Biology Undergraduate Studies Committee, Stanford University (2003 - 2009)
  • Advisor, Biology First Year Graduate Advising, Stanford University (2002 - Present)
  • Advisor, NSF US-EC Task Force on Biotechnology, National Science Foundation (2001 - 2001)
  • Member, International Society of Plant-Microbe Interactions (1996 - Present)

Professional Education


  • Postdoctoral Scholar, University of California, Berkeley, Plant-Microbe Interactions (2001)
  • Postdoctoral Scholar, University of California, Los Angeles, Biochemistry (1995)
  • PhD, University of California, Los Angeles, Biochemistry (1994)
  • BA, Ithaca College, Biochemistry (1989)

Current Research and Scholarly Interests


My laboratory studies the biochemical mechanisms used by bacterial pathogens to alter plant physiology during infection. Extensive genetic and phenotypic data indicate that the bacterial type three secretion (T3S) system and its protein substrates (referred to as T3S effectors) are the major virulence determinants that promote pathogen colonization in plants. The paradigm for T3S effector function has been that these proteins collectively suppress host defense responses to promote colonization and disease progression. The biological function(s) of most T3S effectors, however, is extremely limited and biochemical support for this paradigm is lacking. Thus, the goal of our research has been to elucidate T3S effector function, identify host targets, and provide fundamental knowledge of how perturbation of of distinct nodes in host signaling pathways leads to bacterial pathogenesis. To do so, we study the T3S effectors in Xanthomonas euvesicatoria (Xcv), a Gram-negative, facultative parasite that causes leaf spot disease in tomato and pepper. Understanding how plant innate immunity is regulated and how pathogens manipulate plant hosts is is fundamental knowledge that is required for the development of novel strategies to prevent and/or eliminate plant disease in the field.

Currently, my group is investigating: 1) how Xanthomonas employs a transcription repressor to rewire host transcription during infection to alter immune signaling and growth programs; 2) how Xanthomonas effectors target 14-3-3 phospho-binding proteins to alter immune complexes and signaling; 3) the impact of Xanthomonas-mediated acetylation of host proteins that are involved with lipid signaling and microtubule dynamics; 4) how Xanthomonas uses a "default to death and defense strategy" to promote plant pathogenesis; and 5) unique natural products made during pathogen infection in tomato by applying a untargeted metabolomics in conjunction with transcriptomics to accelerate the discovery of new antimicrobial compounds and their biosynthetic pathways.

2026-27 Courses


Stanford Advisees


  • Doctoral Dissertation Reader (AC)
    Alice Gevorgyan
  • Doctoral Dissertation Advisor (AC)
    Steven Massa, Omar Niagne
  • Doctoral Dissertation Co-Advisor (AC)
    Yalikunjiang Aizezi

Graduate and Fellowship Programs


  • Biology (School of Humanities and Sciences) (PhD Program)

All Publications


  • Linking sugar sensing to immunity in plants via O-glycosylation. bioRxiv : the preprint server for biology Aizezi, Y., Bi, Y., Zhang, H., Kim, J. G., Chaudhary, A., Trinh, C. S., Shen, Q. J., Xu, S. L., Mudgett, M. B., Wang, Z. Y. 2026

    Abstract

    Interaction with microbes can reprogram metabolism and alter nutrient availability in plant cells. How metabolic cues modulate immune responses remains unknown. Here, we show that sugar-sensing O-glycosylation of immune-signaling kinases mediates metabolic regulation of immunity. Under sugar-replete conditions, the MAP kinase kinases (MKK4 and MKK5), key components of pattern-triggered immunity (PTI), are glycosylated by O-GlcNAc and O-fucose in their activation loops and thus cannot be activated by upstream kinases, thereby restricting PTI. Pathogen infection or sugar starvation reduces O-glycosylation of MKK4/5 and enhances immune signaling; these effects are reversed by GDP-fucose treatment, demonstrating that reduced sugar availability decreases O-fucosylation and enhances immune signaling in infected cells. Chemical inhibition of O-fucosylation enhances immunity and pathogen resistance in both Arabidopsis and tomato. Our findings establish O-glycosylation of MKKs as a metabolic rheostat that fine-tunes immune responses according to sugar availability during plant-microbe interactions, providing a new strategy for improving crop health.

    View details for DOI 10.64898/2026.05.04.722566

    View details for PubMedID 42146548

    View details for PubMedCentralID PMC13174333

  • Fast wide-field light sheet electro-optic FLIM OPTICS EXPRESS Knight, V., Bode, N., Dowlatshahi, D. P., Kim, J., Mudgett, M., Wakatsuki, S., Bowman, A. J., Kasevich, M. A. 2026; 34 (8): 15065-15073

    Abstract

    We demonstrate volumetric fluorescence lifetime microscopy (FLIM) using the electro-optic FLIM technique. Images acquired in a selective plane illumination microscope are gated using a Pockels cell driven at 80 MHz, enabling light sheet electro-optic FLIM (LS-EO-FLIM) acquisition with up to 800 μm field of view. Volume acquisitions are demonstrated on fluorescent bead mixtures and in live Arabidopsis thaliana root samples using both genetically encoded fluorescent proteins and endogenous autofluorescence.

    View details for DOI 10.1364/OE.581295

    View details for Web of Science ID 001757811100015

    View details for PubMedID 42071601

  • Characterization of a XopJ2 variant in global population of <i>Xanthomonas perforans</i> Sharma, A., Iruegas-Bocardo, F., Bibi, S., Chen, Y. C., Kim, J. G., Abrahamian, P., Minsavage, G. V., Hulbert, J. C., Vallad, G. E., Mudgett, M. B., Jones, J. B., Goss, E. M. AMER PHYTOPATHOLOGICAL SOC. 2024: 102-103
  • Transcriptome analysis reveals role of transcription factor WRKY70 in early N-hydroxy-pipecolic acid signaling. Plant physiology Foret, J., Kim, J. G., Sattely, E. S., Mudgett, M. B. 2024

    Abstract

    N-hydroxy-pipecolic acid (NHP) is a mobile metabolite essential for inducing and amplifying systemic acquired resistance (SAR) following pathogen attack. Early phases of NHP signaling leading to immunity have remained elusive. Here, we report the early transcriptional changes mediated by NHP and the role salicylic acid (SA) plays during this response in Arabidopsis (Arabidopsis thaliana). We show that distinct waves of expression within minutes to hours of NHP treatment include increased expression of WRKY transcription factor genes as the primary transcriptional response, followed by the induction of WRKY-regulated defense genes as the secondary response. Most genes induced by NHP within minutes were SA-dependent, whereas those induced within hours were SA-independent. These data suggest that NHP induces the primary transcriptional response under basal levels of SA and that new SA biosynthesis via ISOCHORISMATE SYNTHASE 1/SA-INDUCTION DEFICIT 2 (ICS1/SID2) is dispensable for inducing the secondary transcriptional response. We demonstrate that WRKY70 is required for the induced expression of a set of genes defining some of the secondary transcriptional response, SAR protection, and NHP-dependent enhancement of ROS production in response to flagellin treatment. Our study highlights the key genes and pathways defining early NHP responses and the role of WRKY70 in regulating NHP-dependent transcription.

    View details for DOI 10.1093/plphys/kiae544

    View details for PubMedID 39404105

  • Multiple acquisitions of XopJ2 effectors in populations of Xanthomonas perforans. Molecular plant-microbe interactions : MPMI Sharma, A., Iruegas-Bocardo, F., Bibi, S., Chen, Y. C., Kim, J. G., Abrahamian, P., Minsavage, G. V., Hurlbert, J. C., Vallad, G. E., Mudgett, M. B., Jones, J. B., Goss, E. M. 2024

    Abstract

    Type III effectors (T3Es) are major determinants of Xanthomonas virulence and targets for resistance breeding. XopJ2 (syn. AvrBsT) is a highly conserved YopJ-family T3E acquired by X. perforans, the pathogen responsible for bacterial spot disease of tomato. In this study, we characterized a new variant (XopJ2b) of XopJ2, which is predicted to have a similar 3D structure as the canonical XopJ2 (XopJ2a) despite sharing only 70% sequence identity. XopJ2b carries an acetyltransferase domain and the critical residues required for its activity, and the positions of these residues are predicted to be conserved in 3D structure of the proteins. We demonstrated that XopJ2b is a functional T3E and triggers hypersensitive response when translocated into pepper cells. Like XopJ2a, XopJ2b triggers HR in Arabidopsis that is suppressed by the deacetylase, SOBER1. We found xopJ2b in genome sequences of X. euvesicatoria, X. campestris, X. citri, X. guizotiae, and X. vasicola strains, suggesting widespread horizontal transfer. In X. perforans, xopJ2b was present in strains collected in North and South America, Africa, Asia, Australia, and Europe, whereas xopJ2a had a more narrow geographic distribution. This study expands the Xanthomonas T3E repertoire, demonstrates functional conservation in T3E evolution, and further supports the importance of XopJ2 in X. perforans fitness on tomato.

    View details for DOI 10.1094/MPMI-05-24-0048-R

    View details for PubMedID 39102648

  • Dynamic changes of the Prf/Pto tomato resistance complex following effector recognition. Nature communications Sheikh, A. H., Zacharia, I., Pardal, A. J., Dominguez-Ferreras, A., Sueldo, D. J., Kim, J. G., Balmuth, A., Gutierrez, J. R., Conlan, B. F., Ullah, N., Nippe, O. M., Girija, A. M., Wu, C. H., Sessa, G., Jones, A. M., Grant, M. R., Gifford, M. L., Mudgett, M. B., Rathjen, J. P., Ntoukakis, V. 2023; 14 (1): 2568

    Abstract

    In both plants and animals, nucleotide-binding leucine-rich repeat (NLR) immune receptors play critical roles in pathogen recognition and activation of innate immunity. In plants, NLRs recognise pathogen-derived effector proteins and initiate effector-triggered immunity (ETI). However, the molecular mechanisms that link NLR-mediated effector recognition and downstream signalling are not fully understood. By exploiting the well-characterised tomato Prf/Pto NLR resistance complex, we identified the 14-3-3 proteins TFT1 and TFT3 as interacting partners of both the NLR complex and the protein kinase MAPKKKα. Moreover, we identified the helper NRC proteins (NLR-required for cell death) as integral components of the Prf /Pto NLR recognition complex. Notably our studies revealed that TFTs and NRCs interact with distinct modules of the NLR complex and, following effector recognition, dissociate facilitating downstream signalling. Thus, our data provide a mechanistic link between activation of immune receptors and initiation of downstream signalling cascades.

    View details for DOI 10.1038/s41467-023-38103-6

    View details for PubMedID 37142566

    View details for PubMedCentralID 8171942

  • Deconvoluting signals downstream of growth and immune receptor kinases by phosphocodes of the BSU1 family phosphatases. Nature plants Park, C. H., Bi, Y., Youn, J., Kim, S., Kim, J., Xu, N. Y., Shrestha, R., Burlingame, A. L., Xu, S., Mudgett, M. B., Kim, S., Kim, T., Wang, Z. 2022

    Abstract

    Hundreds of leucine-rich repeat receptor kinases (LRR-RKs) have evolved to control diverse processes of growth, development and immunity in plants, but the mechanisms that link LRR-RKs to distinct cellular responses are not understood. Here we show that two LRR-RKs, the brassinosteroid hormone receptor BRASSINOSTEROID INSENSITIVE 1 (BRI1) and the flagellin receptor FLAGELLIN SENSING 2 (FLS2), regulate downstream glycogen synthase kinase 3 (GSK3) and mitogen-activated protein (MAP) kinases, respectively, through phosphocoding of the BRI1-SUPPRESSOR1 (BSU1) phosphatase. BSU1 was previously identified as a component that inactivates GSK3s in the BRI1 pathway. We surprisingly found that the loss of the BSU1 family phosphatases activates effector-triggered immunity and impairs flagellin-triggered MAP kinase activation and immunity. The flagellin-activated BOTRYTIS-INDUCED KINASE 1 (BIK1) phosphorylates BSU1 at serine 251. Mutation of serine 251 reduces BSU1's ability to mediate flagellin-induced MAP kinase activation and immunity, but not its abilities to suppress effector-triggered immunity and interact with GSK3, which is enhanced through the phosphorylation of BSU1 at serine 764 upon brassinosteroid signalling. These results demonstrate that BSU1 plays an essential role in immunity and transduces brassinosteroid-BRI1 and flagellin-FLS2 signals using different phosphorylation sites. Our study illustrates that phosphocoding in shared downstream components provides signalling specificities for diverse plant receptor kinases.

    View details for DOI 10.1038/s41477-022-01167-1

    View details for PubMedID 35697730

  • A bacterial effector counteracts host autophagy by promoting degradation of an autophagy component. The EMBO journal Leong, J. X., Raffeiner, M., Spinti, D., Langin, G., Franz-Wachtel, M., Guzman, A. R., Kim, J. G., Pandey, P., Minina, A. E., Macek, B., Hafrén, A., Bozkurt, T. O., Mudgett, M. B., Börnke, F., Hofius, D., Üstün, S. 2022: e110352

    Abstract

    Beyond its role in cellular homeostasis, autophagy plays anti- and promicrobial roles in host-microbe interactions, both in animals and plants. One prominent role of antimicrobial autophagy is to degrade intracellular pathogens or microbial molecules, in a process termed xenophagy. Consequently, microbes evolved mechanisms to hijack or modulate autophagy to escape elimination. Although well-described in animals, the extent to which xenophagy contributes to plant-bacteria interactions remains unknown. Here, we provide evidence that Xanthomonas campestris pv. vesicatoria (Xcv) suppresses host autophagy by utilizing type-III effector XopL. XopL interacts with and degrades the autophagy component SH3P2 via its E3 ligase activity to promote infection. Intriguingly, XopL is targeted for degradation by defense-related selective autophagy mediated by NBR1/Joka2, revealing a complex antagonistic interplay between XopL and the host autophagy machinery. Our results implicate plant antimicrobial autophagy in the depletion of a bacterial virulence factor and unravel an unprecedented pathogen strategy to counteract defense-related autophagy in plant-bacteria interactions.

    View details for DOI 10.15252/embj.2021110352

    View details for PubMedID 35620914

  • Arabidopsis UGT76B1 glycosylates N-hydroxy-pipecolic acid and inactivates systemic acquired resistance in tomato. The Plant cell Holmes, E. C., Chen, Y., Mudgett, M. B., Sattely, E. S. 2021

    Abstract

    Systemic acquired resistance (SAR) is a mechanism that plants utilize to connect a local pathogen infection to global defense responses. N-hydroxy-pipecolic acid (NHP) and a glycosylated derivative are produced during SAR, yet their individual roles in this process are currently unclear. Here, we report that Arabidopsis thaliana UGT76B1 generated glycosylated NHP (NHP-Glc) in vitro and when transiently expressed alongside Arabidopsis NHP biosynthetic genes in two Solanaceous plants. During infection, Arabidopsis ugt76b1 mutants did not accumulate NHP-Glc and accumulated less glycosylated salicylic acid (SA-Glc) than wild-type plants. The metabolic changes in ugt76b1 plants were accompanied by enhanced defense to the bacterial pathogen Pseudomonas syringae, suggesting that glycosylation of the SAR molecules NHP and salicylic acid by UGT76B1 plays an important role in modulating defense responses. Transient expression of Arabidopsis UGT76B1 with the Arabidopsis NHP biosynthesis genes ALD1 and FMO1 in tomato (Solanum lycopersicum) increased NHP-Glc production and reduced NHP accumulation in local tissue and abolished the systemic resistance seen when expressing NHP-biosynthetic genes alone. These findings reveal that the glycosylation of NHP by UGT76B1 alters defense priming in systemic tissue and provide further evidence for the role of the NHP aglycone as the active metabolite in SAR signaling.

    View details for DOI 10.1093/plcell/koaa052

    View details for PubMedID 33624103

  • Arabidopsis bZIP11 is a susceptibility factor during Pseudomonas syringae infection. Molecular plant-microbe interactions : MPMI Prior, M. J., Selvanayagam, J., Kim, J., Tomar, M., Jonikas, M., Mudgett, M. B., Smeekens, S., Hanson, J., Frommer, W. B. 2021

    Abstract

    The induction of plant nutrient secretion systems is critical for successful pathogen infection. Some bacterial pathogens, e.g. Xanthomonas species, use TAL (transcription activator-like) effectors to induce transcription of SWEET sucrose efflux transporters. Pseudomonas syringae pathovar (pv.) tomato strain DC3000 lacks TAL effectors, yet is able to induce multiple SWEETs in Arabidopsis thaliana by unknown mechanisms. Since bacteria require other nutrients besides sugars for efficient reproduction, we hypothesized that Pseudomonas may depend on host transcription factors involved in secretory programs to increase access to essential nutrients. Bioinformatic analyses identified the Arabidopsis basic-leucine zipper transcription factor bZIP11 as a potential regulator of nutrient transporters, including SWEETs and UmamiT amino acid transporters. Inducible downregulation of bZIP11 expression in Arabidopsis resulted in reduced growth of P. syringae pv. tomato strain DC3000, whereas inducible overexpression of bZIP11 resulted in increased bacterial growth, supporting the hypothesis that bZIP11 regulated transcription programs are essential for maximal pathogen titer in leaves. Our data are consistent with a model in which a pathogen alters host transcription factor expression upstream of secretory transcription networks to promote nutrient efflux from host cells.

    View details for DOI 10.1094/MPMI-11-20-0310-R

    View details for PubMedID 33400562

  • Arabidopsis UGT76B1 glycosylates N-hydroxy-pipecolic acid and inactivates systemic acquired resistance in tomato. The Plant cell Holmes, E. C., Chen, Y. C., Mudgett, M. B., Sattely, E. S. 2021; 33 (3): 750–65

    Abstract

    Systemic acquired resistance (SAR) is a mechanism that plants utilize to connect a local pathogen infection to global defense responses. N-hydroxy-pipecolic acid (NHP) and a glycosylated derivative are produced during SAR, yet their individual roles in this process are currently unclear. Here, we report that Arabidopsis thaliana UGT76B1 generated glycosylated NHP (NHP-Glc) in vitro and when transiently expressed alongside Arabidopsis NHP biosynthetic genes in two Solanaceous plants. During infection, Arabidopsis ugt76b1 mutants did not accumulate NHP-Glc and accumulated less glycosylated salicylic acid (SA-Glc) than wild-type plants. The metabolic changes in ugt76b1 plants were accompanied by enhanced defense to the bacterial pathogen Pseudomonas syringae, suggesting that glycosylation of the SAR molecules NHP and salicylic acid by UGT76B1 plays an important role in modulating defense responses. Transient expression of Arabidopsis UGT76B1 with the Arabidopsis NHP biosynthesis genes ALD1 and FMO1 in tomato (Solanum lycopersicum) increased NHP-Glc production and reduced NHP accumulation in local tissue and abolished the systemic resistance seen when expressing NHP-biosynthetic genes alone. These findings reveal that the glycosylation of NHP by UGT76B1 alters defense priming in systemic tissue and provide further evidence for the role of the NHP aglycone as the active metabolite in SAR signaling.

    View details for DOI 10.1093/plcell/koaa052

    View details for PubMedID 33955491

  • Tomato Atypical Receptor Kinase1 is involved in the regulation of pre-invasion defense. Plant physiology Guzman, A. R., Kim, J., Taylor, K. W., Lanver, D., Mudgett, M. B. 2020

    Abstract

    Tomato Atypical Receptor Kinase 1 (TARK1) is a pseudokinase required for post-invasion immunity. TARK1 was originally identified as a target of the Xanthomonas euvesicatoria effector protein Xanthomonas outer protein N (XopN), a suppressor of early defense signaling. How TARK1 participates in immune signal transduction is not well understood. To gain insight into TARK1's role in tomato (Solanum lycopersicum) immunity, we used a proteomics approach to isolate and identify TARK1-associated immune complexes formed during infection. We found that TARK1 interacts with proteins predicted to be associated with stomatal movement. TARK1 CRISPR mutants and overexpression (OE) lines did not display differences in light-induced stomatal opening or abscisic acid-induced stomatal closure; however, they did show altered stomatal movement responses to bacteria and biotic elicitors. Notably, we found that TARK1 CRISPR plants were resistant to Pst WT (Pseudomonas syringae pathovar tomato strain DC300)-induced stomatal reopening, and TARK1 OE plants were insensitive to Pst COR- (Pst strain DC3118, coronatine deficit)-induced stomatal closure. We also found that TARK1 OE in leaves resulted in increased susceptibility to bacterial invasion. Collectively, our results indicate that TARK1 functions in stomatal movement only in response to biotic elicitors and support a model in which TARK1 regulates stomatal opening post-elicitation.

    View details for DOI 10.1104/pp.19.01400

    View details for PubMedID 32385090

  • A Pathogen-Responsive Gene Cluster for Highly Modified Fatty Acids in Tomato. Cell Jeon, J. E., Kim, J. G., Fischer, C. R., Mehta, N. n., Dufour-Schroif, C. n., Wemmer, K. n., Mudgett, M. B., Sattely, E. n. 2020; 180 (1): 176–87.e19

    Abstract

    In response to biotic stress, plants produce suites of highly modified fatty acids that bear unusual chemical functionalities. Despite their chemical complexity and proposed roles in pathogen defense, little is known about the biosynthesis of decorated fatty acids in plants. Falcarindiol is a prototypical acetylenic lipid present in carrot, tomato, and celery that inhibits growth of fungi and human cancer cell lines. Using a combination of untargeted metabolomics and RNA sequencing, we discovered a biosynthetic gene cluster in tomato (Solanum lycopersicum) required for falcarindiol production. By reconstituting initial biosynthetic steps in a heterologous host and generating transgenic pathway mutants in tomato, we demonstrate a direct role of the cluster in falcarindiol biosynthesis and resistance to fungal and bacterial pathogens in tomato leaves. This work reveals a mechanism by which plants sculpt their lipid pool in response to pathogens and provides critical insight into the complex biochemistry of alkynyl lipid production.

    View details for DOI 10.1016/j.cell.2019.11.037

    View details for PubMedID 31923394

  • An engineered pathway for N-hydroxy-pipecolic acid synthesis enhances systemic acquired resistance in tomato. Science signaling Holmes, E. C., Chen, Y., Sattely, E. S., Mudgett, M. B. 2019; 12 (604)

    Abstract

    Systemic acquired resistance (SAR) is a powerful immune response that triggers broad-spectrum disease resistance throughout a plant. In the model plant Arabidopsis thaliana, long-distance signaling and SAR activation in uninfected tissues occur without circulating immune cells and instead rely on the metabolite N-hydroxy-pipecolic acid (NHP). Engineering SAR in crop plants would enable external control of a plant's ability to mount a global defense response upon sudden changes in the environment. Such a metabolite-engineering approach would require the molecular machinery for producing and responding to NHP in the crop plant. Here, we used heterologous expression in Nicotiana benthamiana leaves to identify a minimal set of Arabidopsis genes necessary for the biosynthesis of NHP. Local expression of these genes in tomato leaves triggered SAR in distal tissues in the absence of a pathogen, suggesting that the SAR trait can be engineered to enhance a plant's endogenous ability to respond to pathogens. We also showed tomato produces endogenous NHP in response to a bacterial pathogen and that NHP is present across the plant kingdom, raising the possibility that an engineering strategy to enhance NHP-induced defenses could be possible in many crop plants.

    View details for DOI 10.1126/scisignal.aay3066

    View details for PubMedID 31641079

  • Aphid effector Me10 interacts with tomato TFT7, a 14-3-3 isoform involved in aphid resistance NEW PHYTOLOGIST Chaudhary, R., Peng, H., He, J., MacWilliams, J., Teixeira, M., Tsuchiya, T., Chesnais, Q., Mudgett, M., Kaloshian, I. 2019; 221 (3): 1518–28

    View details for DOI 10.1111/nph.15475

    View details for Web of Science ID 000459828900033

  • Tomato bHLH132 transcription factor controls growth and defense and is activated by Xanthomonas euvesicatoria effector XopD during pathogenesis. Molecular plant-microbe interactions : MPMI Kim, J. G., Mudgett, M. B. 2019

    Abstract

    Effector-dependent manipulation of host transcription is a key virulence mechanism used by Xanthomonas species causing bacterial spot disease in tomato and pepper. Transcription activator-like (TAL) effectors employ novel DNA-binding domains to directly activate host transcription, whereas the non-TAL effector XopD uses a small ubiquitin-like modifier (SUMO) protease activity to represses host transcription. The targets of TAL and non-TAL effectors provide insight to the genes governing susceptibility and resistance during Xanthomonas infection. In this study, we investigated the extent to which the non-TAL effector strain Xe85-10 activates tomato transcription to gain new insight to the transcriptional circuits and virulence mechanisms associated with X. euvesicatoria pathogenesis. Using transcriptional profiling, we identified a putative basic-helix-loop-helix (bHLH) transcription factor, bHLH132, as a pathogen-responsive gene that is moderately induced by microbe-associated molecular patterns and defense hormones, and highly induced by XopD during X. euvesicatoria infection. We also found that activation of bHLH132 transcription requires XopD's SUMO protease activity. Silencing bHLH132 mRNA expression results in stunted tomato plants with enhanced susceptibility to X. euvesicatoria infection. Our work suggests that bHLH132 is required for normal vegetative growth and development, as well as resistance to X. euvesicatoria. It also suggests new transcription-based models describing XopD virulence and recognition in tomato.

    View details for DOI 10.1094/MPMI-05-19-0122-R

    View details for PubMedID 31322482

  • Tomato 14-3-3 Proteins Are Required for Xv3 Disease Resistance and Interact with a Subset of Xanthomonas euvesicatoria Effectors MOLECULAR PLANT-MICROBE INTERACTIONS Dubrow, Z., Sunitha, S., Kim, J., Aakre, C. D., Girija, A., Sobol, G., Teper, D., Chen, Y., Ozbaki-Yagan, N., Vance, H., Sessa, G., Mudgett, M. 2018; 31 (12): 1301–11
  • Aphid effector Me10 interacts with tomato TFT7, a 14-3-3 isoform involved in aphid resistance. The New phytologist Chaudhary, R., Peng, H., He, J., MacWilliams, J., Teixeira, M., Tsuchiya, T., Chesnais, Q., Mudgett, M. B., Kaloshian, I. 2018

    Abstract

    We demonstrated previously that expression of Macrosiphum euphorbiae salivary protein Me10 enhanced aphid reproduction on its host tomato (Solanum lycopersicum). However, the mechanism of action of Me10 remained elusive. To confirm the secretion of Me10 by the aphid into plant tissues, we produced Me10 polyclonal antibodies. To identify the plant targets of Me10, we developed a tomato immune induced complementary DNA yeast two-hybrid library and screened it with Me10 as bait. Immunoprecipitation and bimolecular fluorescence complementation (BiFC) assays were performed to validate one of the interactions in planta, and virus-induced gene silencing was used for functional characterization in tomato. We demonstrated that Me10 is secreted into the plant tissues and interacts with tomato 14-3-3 isoform7 (TFT7) in yeast. Immunoprecipitation assays confirmed that Me10 and its homologue in Aphis gossypii, Ag10k, interact with TFT7 in planta. Further, BiFC revealed that Me10 interaction with TFT7 occurs in the plant cell cytoplasm. While silencing of TFT7 in tomato leaves did not affect tomato susceptibility to M.euphorbiae, it enhanced longevity and fecundity of A.gossypii, the non-host aphid. Our results suggest the model whereby TFT7 plays a role in aphid resistance in tomato and effectors of the Me10/Ag10k family interfere with TFT7 function during aphid infestation.

    View details for PubMedID 30357852

  • Tomato 14-3-3 proteins are required for Xv3 disease resistance and interact with a subset of Xanthomonas euvesicatoria effectors. Molecular plant-microbe interactions : MPMI Dubrow, Z., Sunitha, S., Kim, J., Aakre, C., Girija, A. M., Sobol, G., Teper, D., Chen, Y., Ozbaki-Yagan, N., Vance, H., Sessa, G., Mudgett, M. B. 2018

    Abstract

    14-3-3s are phospho-binding proteins with scaffolding activity that play central roles in the regulation of enzymes and signaling complexes in eukaryotes. In plants, 14-3-3 isoforms are required for disease resistance and key targets of pathogen effectors. Here, we examined the requirement of the tomato (Solanum lycopersicum) 14-3-3 (TFT) protein family for Xv3 disease resistance in response to the bacterial pathogen Xanthomonas euvesicatoria. In addition, we determined if tomato 14-3-3 proteins interact with the repertoire of X. euvesicatoria type III secretion effector proteins, including AvrXv3 the elicitor of Xv3 resistance. We show that multiple tomato 14-3-3 isoforms contribute to Xv3 resistance. We also show that one or more tomato 14-3-3s physically interact with multiple effectors (AvrXv3, XopE1, XopE2, XopN, XopO, XopQ, and XopAU). Genetic analyses indicate that none of the identified effectors interfere with AvrXv3-elicited resistance into Xv3 tomato leaves; however, XopE1, XopE2 and XopO are required to suppress symptom development in susceptible tomato leaves. Phospho-peptide mapping revealed that XopE2 is phosphorylated at multiple residues in planta and residues T66, T131 and S334 are required for maximal binding to TFT10. Together, our data support the hypothesis that multiple tomato 14-3-3 isoforms are involved in immune signaling during X. euvesicatoria infection.

    View details for PubMedID 29947282

  • N-hydroxy-pipecolic acid is a mobile metabolite that induces systemic disease resistance in Arabidopsis PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA Chen, Y., Holmes, E. C., Rajniak, J., Kim, J., Tang, S., Fischer, C. R., Mudgett, M., Sattely, E. S. 2018; 115 (21): E4920–E4929

    Abstract

    Systemic acquired resistance (SAR) is a global response in plants induced at the site of infection that leads to long-lasting and broad-spectrum disease resistance at distal, uninfected tissues. Despite the importance of this priming mechanism, the identity and complexity of defense signals that are required to initiate SAR signaling is not well understood. In this paper, we describe a metabolite, N-hydroxy-pipecolic acid (N-OH-Pip) and provide evidence that this mobile molecule plays a role in initiating SAR signal transduction in Arabidopsis thaliana We demonstrate that FLAVIN-DEPENDENT MONOOXYGENASE 1 (FMO1), a key regulator of SAR-associated defense priming, can synthesize N-OH-Pip from pipecolic acid in planta, and exogenously applied N-OH-Pip moves systemically in Arabidopsis and can rescue the SAR-deficiency of fmo1 mutants. We also demonstrate that N-OH-Pip treatment causes systemic changes in the expression of pathogenesis-related genes and metabolic pathways throughout the plant and enhances resistance to a bacterial pathogen. This work provides insight into the chemical nature of a signal for SAR and also suggests that the N-OH-Pip pathway is a promising target for metabolic engineering to enhance disease resistance.

    View details for PubMedID 29735713

  • Quantification of Ethylene Production in Tomato Leaves Infected by Xanthomonas euvesicatoria. Bio-protocol Kim, J., Stork, W., Mudgett, M. B. 2016; 6 (3)

    Abstract

    Ethylene is a gaseous plant hormone controlling fruit ripening, flower opening, leaf senescence as well as abscission, and disease symptom development. Ethylene plays a critical role in the bacterial pathogen Xanthomonas euvesicatoria (X. euvesicatoria)-elicited symptom development in tomato. This protocol describes the measurement of ethylene gas produced by tomato leaves infected with X. euvesicatoria. Infected leaflets are placed in a glass tube for 30 min without sealing. The glass tubes are then capped with a septa stopper, and incubated for an hour. A 1 ml gas sample is removed from the tube using a syringe and then injected into a gas chromatograph to quantify ethylene gas levels. This protocol will be applicable for other plants with other pathogens with modifications.

    View details for PubMedID 27446982

  • Functional Analysis of Plant Defense Suppression and Activation by the Xanthomonas Core Type III Effector XopX MOLECULAR PLANT-MICROBE INTERACTIONS Stork, W., Kim, J., Mudgett, M. B. 2015; 28 (2): 180-194

    Abstract

    Many phytopathogenic type III secretion effector proteins (T3Es) have been shown to target and suppress plant immune signaling but perturbation of the plant immune system by T3Es can also elicit a plant response. XopX is a "core" Xanthomonas T3E that contributes to growth and symptom development during Xanthomonas euvesicatoria infection of tomato but its functional role is undefined. We tested the effect of XopX on several aspects of plant immune signaling. XopX promoted ethylene production and plant cell death (PCD) during X. euvesicatoria infection of susceptible tomato and in transient expression assays in Nicotiana benthamiana, which is consistent with its requirement for the development of X. euvesicatoria-induced disease symptoms. Additionally, although XopX suppressed flagellin-induced reactive oxygen species, it promoted the accumulation of pattern-triggered immunity (PTI) gene transcripts. Surprisingly, XopX coexpression with other PCD elicitors resulted in delayed PCD, suggesting antagonism between XopX-dependent PCD and other PCD pathways. However, we found no evidence that XopX contributed to the suppression of effector-triggered immunity during X. euvesicatoria-tomato interactions, suggesting that XopX's primary virulence role is to modulate PTI. These results highlight the dual role of a core Xanthomonas T3E in simultaneously suppressing and activating plant defense responses.

    View details for DOI 10.1094/MPMI-09-14-0263-R

    View details for Web of Science ID 000347914700007

    View details for PubMedID 25338145

    View details for PubMedCentralID PMC4293322

  • A Comprehensive Analysis of MicroProteins Reveals Their Potentially Widespread Mechanism of Transcriptional Regulation. Plant physiology Magnani, E., de Klein, N., Nam, H., Kim, J., Pham, K., Fiume, E., Mudgett, M. B., Rhee, S. Y. 2014; 165 (1): 149-159

    Abstract

    Truncated transcription factor-like proteins called microProteins (miPs) can modulate transcription factor activities, thereby increasing transcriptional regulatory complexity. To understand their prevalence, evolution, and function, we predicted over 400 genes that encode putative miPs from Arabidopsis (Arabidopsis thaliana) using a bioinformatics pipeline and validated two novel miPs involved in flowering time and response to abiotic and biotic stress. We provide an evolutionary perspective for a class of miPs targeting homeodomain transcription factors in plants and metazoans. We identify domain loss as one mechanism of miP evolution and suggest the possible roles of miPs on the evolution of their target transcription factors. Overall, we reveal a prominent layer of transcriptional regulation by miPs, show pervasiveness of such proteins both within and across genomes, and provide a framework for studying their function and evolution.

    View details for DOI 10.1104/pp.114.235903

    View details for PubMedID 24616380

    View details for PubMedCentralID PMC4012575

  • The bHLH Transcription Factor HBI1 Mediates the Trade-Off between Growth and Pathogen-Associated Molecular Pattern-Triggered Immunity in Arabidopsis. Plant cell Fan, M., Bai, M., Kim, J., Wang, T., Oh, E., Chen, L., Park, C. H., Son, S., Kim, S., Mudgett, M. B., Wang, Z. 2014; 26 (2): 828-841

    Abstract

    The trade-off between growth and immunity is crucial for survival in plants. However, the mechanism underlying growth-immunity balance has remained elusive. The PRE-IBH1-HBI1 tripartite helix-loop-helix/basic helix-loop-helix module is part of a central transcription network that mediates growth regulation by several hormonal and environmental signals. Here, genome-wide analyses of HBI1 target genes show that HBI1 regulates both overlapping and unique targets compared with other DNA binding components of the network in Arabidopsis thaliana, supporting a role in specifying network outputs and fine-tuning feedback regulation. Furthermore, HBI1 negatively regulates a subset of genes involved in immunity, and pathogen-associated molecular pattern (PAMP) signals repress HBI1 transcription. Constitutive overexpression and loss-of-function experiments show that HBI1 inhibits PAMP-induced growth arrest, defense gene expression, reactive oxygen species production, and resistance to pathogen. These results show that HBI1, as a component of the central growth regulation circuit, functions as a major node of crosstalk that mediates a trade-off between growth and immunity in plants.

    View details for DOI 10.1105/tpc.113.121111

    View details for PubMedID 24550223

    View details for PubMedCentralID PMC3967043

  • AvrBsT acetylates Arabidopsis ACIP1, a protein that associates with microtubules and is required for immunity. PLoS pathogens Cheong, M. S., Kirik, A., Kim, J., Frame, K., Kirik, V., Mudgett, M. B. 2014; 10 (2)

    Abstract

    Bacterial pathogens of plant and animals share a homologous group of virulence factors, referred to as the YopJ effector family, which are translocated by the type III secretion (T3S) system into host cells during infection. Recent work indicates that some of these effectors encode acetyltransferases that suppress host immunity. The YopJ-like protein AvrBsT is known to activate effector-triggered immunity (ETI) in Arabidopsis thaliana Pi-0 plants; however, the nature of its enzymatic activity and host target(s) has remained elusive. Here we report that AvrBsT possesses acetyltransferase activity and acetylates ACIP1 (for ACETYLATED INTERACTING PROTEIN1), an unknown protein from Arabidopsis. Genetic studies revealed that Arabidopsis ACIP family members are required for both pathogen-associated molecular pattern (PAMP)-triggered immunity and AvrBsT-triggered ETI during Pseudomonas syringae pathovar tomato DC3000 (Pst DC3000) infection. Microscopy studies revealed that ACIP1 is associated with punctae on the cell cortex and some of these punctae co-localize with microtubules. These structures were dramatically altered during infection. Pst DC3000 or Pst DC3000 AvrRpt2 infection triggered the formation of numerous, small ACIP1 punctae and rods. By contrast, Pst DC3000 AvrBsT infection primarily triggered the formation of large GFP-ACIP1 aggregates, in an acetyltransferase-dependent manner. Our data reveal that members of the ACIP family are new components of the defense machinery required for anti-bacterial immunity. They also suggest that AvrBsT-dependent acetylation in planta alters ACIP1's defense function, which is linked to the activation of ETI.

    View details for DOI 10.1371/journal.ppat.1003952

    View details for PubMedID 24586161

    View details for PubMedCentralID PMC3930583

  • A robust methodology to subclassify pseudokinases based on their nucleotide-binding properties. Biochemical journal Murphy, J. M., Zhang, Q., Young, S. N., Reese, M. L., Bailey, F. P., Eyers, P. A., Ungureanu, D., Hammaren, H., Silvennoinen, O., Varghese, L. N., Chen, K., Tripaydonis, A., Jura, N., Fukuda, K., Qin, J., Nimchuk, Z., Mudgett, M. B., Elowe, S., Gee, C. L., Liu, L., Daly, R. J., Manning, G., Babon, J. J., Lucet, I. S. 2014; 457 (2): 323-334

    Abstract

    Protein kinase-like domains that lack conserved residues known to catalyse phosphoryl transfer, termed pseudokinases, have emerged as important signalling domains across all kingdoms of life. Although predicted to function principally as catalysis-independent protein-interaction modules, several pseudokinase domains have been attributed unexpected catalytic functions, often amid controversy. We established a thermal-shift assay as a benchmark technique to define the nucleotide-binding properties of kinase-like domains. Unlike in vitro kinase assays, this assay is insensitive to the presence of minor quantities of contaminating kinases that may otherwise lead to incorrect attribution of catalytic functions to pseudokinases. We demonstrated the utility of this method by classifying 31 diverse pseudokinase domains into four groups: devoid of detectable nucleotide or cation binding; cation-independent nucleotide binding; cation binding; and nucleotide binding enhanced by cations. Whereas nine pseudokinases bound ATP in a divalent cation-dependent manner, over half of those examined did not detectably bind nucleotides, illustrating that pseudokinase domains predominantly function as non-catalytic protein-interaction modules within signalling networks and that only a small subset is potentially catalytically active. We propose that henceforth the thermal-shift assay be adopted as the standard technique for establishing the nucleotide-binding and catalytic potential of kinase-like domains.

    View details for DOI 10.1042/BJ20131174

    View details for PubMedID 24107129

  • Xanthomonas euvesicatoria typeIII effector XopQ interacts with tomato and pepper 14-3-3 isoforms to suppress effector-triggered immunity PLANT JOURNAL Teper, D., Salomon, D., Sunitha, S., Kim, J., Mudgett, M. B., Sessa, G. 2014; 77 (2): 297-309

    Abstract

    Effector-triggered immunity (ETI) to host-adapted pathogens is associated with rapid cell death at the infection site. The plant-pathogenic bacterium Xanthomonas euvesicatoria (Xcv) interferes with plant cellular processes by injecting effector proteins into host cells through the type III secretion system. Here, we show that the Xcv effector XopQ suppresses cell death induced by components of the ETI-associated MAP kinase cascade MAPKKKα MEK2/SIPK and by several R/avr gene pairs. Inactivation of xopQ by insertional mutagenesis revealed that this effector inhibits ETI-associated cell death induced by avirulent Xcv in resistant pepper (Capsicum annuum), and enhances bacterial growth in resistant pepper and tomato (Solanum lycopersicum). Using protein-protein interaction studies in yeast (Saccharomyces cerevisiae) and in planta, we identified the tomato 14-3-3 isoform SlTFT4 and homologs from other plant species as XopQ interactors. A mutation in the putative 14-3-3 binding site of XopQ impaired interaction of the effector with CaTFT4 in yeast and its virulence function in planta. Consistent with a role in ETI, TFT4 mRNA abundance increased during the incompatible interaction of tomato and pepper with Xcv. Silencing of NbTFT4 in Nicotiana benthamiana significantly reduced cell death induced by MAPKKKα. In addition, silencing of CaTFT4 in pepper delayed the appearance of ETI-associated cell death and enhanced growth of virulent and avirulent Xcv, demonstrating the requirement of TFT4 for plant immunity to Xcv. Our results suggest that the XopQ virulence function is to suppress ETI and immunity-associated cell death by interacting with TFT4, which is an important component of ETI and a bona fide target of XopQ.

    View details for DOI 10.1111/tpj.12391

    View details for Web of Science ID 000337545400011

  • Xanthomonas euvesicatoria type III effector XopQ interacts with tomato and pepper 14-3-3 isoforms to suppress effector-triggered immunity. The Plant journal : for cell and molecular biology Teper, D., Salomon, D., Sunitha, S., Kim, J. G., Mudgett, M. B., Sessa, G. 2013

    Abstract

    Effector-triggered immunity (ETI) to host-adapted pathogens is associated with rapid cell death at the infection site. The plant-pathogenic bacterium Xanthomonas euvesicatoria (Xcv) interferes with plant cellular processes by injecting effector proteins into host cells through the type III secretion system. Here, we show that the Xcv effector XopQ suppresses cell death induced by components of the ETI-associated MAP kinase cascade MAPKKKα MEK2/SIPK and by several R/avr gene pairs. Inactivation of xopQ by insertional mutagenesis revealed that this effector inhibits ETI-associated cell death induced by avirulent Xcv in resistant pepper (Capsicum annuum), and enhances bacterial growth in resistant pepper and tomato (Solanum lycopersicum). Using protein-protein interaction studies in yeast (Saccharomyces cerevisiae) and in planta, we identified the tomato 14-3-3 isoform SlTFT4 and homologs from other plant species as XopQ interactors. A mutation in the putative 14-3-3 binding site of XopQ impaired interaction of the effector with CaTFT4 in yeast and its virulence function in planta. Consistent with a role in ETI, TFT4 mRNA abundance increased during the incompatible interaction of tomato and pepper with Xcv. Silencing of NbTFT4 in Nicotiana benthamiana significantly reduced cell death induced by MAPKKKα. In addition, silencing of CaTFT4 in pepper delayed the appearance of ETI-associated cell death and enhanced growth of virulent and avirulent Xcv, demonstrating the requirement of TFT4 for plant immunity to Xcv. Our results suggest that the XopQ virulence function is to suppress ETI and immunity-associated cell death by interacting with TFT4, which is an important component of ETI and a bona fide target of XopQ.

    View details for DOI 10.1111/tpj.12391

    View details for PubMedID 24279912

  • Xanthomonas type III effector XopD desumoylates tomato transcription factor SlERF4 to suppress ethylene responses and promote pathogen growth. Cell host & microbe Kim, J., Stork, W., Mudgett, M. B. 2013; 13 (2): 143-154

    Abstract

    XopD, a type III secretion effector from Xanthomonas euvesicatoria (Xcv), the causal agent of bacterial spot of tomato, is required for pathogen growth and delay of host symptom development. XopD carries a C-terminal SUMO protease domain, a host range determining nonspecific DNA-binding domain and two EAR motifs typically found in repressors of stress-induced transcription. The precise target(s) and mechanism(s) of XopD are obscure. We report that XopD directly targets the tomato ethylene responsive transcription factor SlERF4 to suppress ethylene production, which is required for anti-Xcv immunity and symptom development. SlERF4 expression was required for Xcv ΔxopD-induced ethylene production and ethylene-stimulated immunity. XopD colocalized with SlERF4 in subnuclear foci and catalyzed SUMO1 hydrolysis from lysine 53 of SlERF4, causing SlERF4 destabilization. Mutation of lysine 53 prevented SlERF4 sumoylation, decreased SlERF4 levels, and reduced SlERF4 transcription. These data suggest that XopD desumoylates SlERF4 to repress ethylene-induced transcription required for anti-Xcv immunity.

    View details for DOI 10.1016/j.chom.2013.01.006

    View details for PubMedID 23414755

    View details for PubMedCentralID PMC3622456

  • XopD Peptidase HANDBOOK OF PROTEOLYTIC ENZYMES, VOLS 1 AND 2, 3RD EDITION Kim, J., Mudgett, M. edited by Rawlings, N. D., Salvesen, G. S. 2013: 2382–85
  • Regulation of Cell Wall-Bound Invertase in Pepper Leaves by Xanthomonas campestris pv. vesicatoria Type Three Effectors PLOS ONE Sonnewald, S., Priller, J. P., Schuster, J., Glickmann, E., Hajirezaei, M., Siebig, S., Mudgett, M. B., Sonnewald, U. 2012; 7 (12)

    Abstract

    Xanthomonas campestris pv. vesicatoria (Xcv) possess a type 3 secretion system (T3SS) to deliver effector proteins into its Solanaceous host plants. These proteins are involved in suppression of plant defense and in reprogramming of plant metabolism to favour bacterial propagation. There is increasing evidence that hexoses contribute to defense responses. They act as substrates for metabolic processes and as metabolic semaphores to regulate gene expression. Especially an increase in the apoplastic hexose-to-sucrose ratio has been suggested to strengthen plant defense. This shift is brought about by the activity of cell wall-bound invertase (cw-Inv). We examined the possibility that Xcv may employ type 3 effector (T3E) proteins to suppress cw-Inv activity during infection. Indeed, pepper leaves infected with a T3SS-deficient Xcv strain showed a higher level of cw-Inv mRNA and enzyme activity relative to Xcv wild type infected leaves. Higher cw-Inv activity was paralleled by an increase in hexoses and mRNA abundance for the pathogenesis-related gene PRQ. These results suggest that Xcv suppresses cw-Inv activity in a T3SS-dependent manner, most likely to prevent sugar-mediated defense signals. To identify Xcv T3Es that regulate cw-Inv activity, a screen was performed with eighteen Xcv strains, each deficient in an individual T3E. Seven Xcv T3E deletion strains caused a significant change in cw-Inv activity compared to Xcv wild type. Among them, Xcv lacking the xopB gene (Xcv ΔxopB) caused the most prominent increase in cw-Inv activity. Deletion of xopB increased the mRNA abundance of PRQ in Xcv ΔxopB-infected pepper leaves, but not of Pti5 and Acre31, two PAMP-triggered immunity markers. Inducible expression of XopB in transgenic tobacco inhibited Xcv-mediated induction of cw-Inv activity observed in wild type plants and resulted in severe developmental phenotypes. Together, these data suggest that XopB interferes with cw-Inv activity in planta to suppress sugar-enhanced defense responses during Xcv infection.

    View details for DOI 10.1371/journal.pone.0051763

    View details for Web of Science ID 000312386800079

    View details for PubMedID 23272161

    View details for PubMedCentralID PMC3522709

  • Tomato TFT1 Is Required for PAMP-Triggered Immunity and Mutations that Prevent T3S Effector XopN from Binding to TFT1 Attenuate Xanthomonas Virulence PLOS PATHOGENS Taylor, K. W., Kim, J., Su, X. B., Aakre, C. D., Roden, J. A., Adams, C. M., Mudgett, M. B. 2012; 8 (6)

    Abstract

    XopN is a type III effector protein from Xanthomonas campestris pathovar vesicatoria that suppresses PAMP-triggered immunity (PTI) in tomato. Previous work reported that XopN interacts with the tomato 14-3-3 isoform TFT1; however, TFT1's role in PTI and/or XopN virulence was not determined. Here we show that TFT1 functions in PTI and is a XopN virulence target. Virus-induced gene silencing of TFT1 mRNA in tomato leaves resulted in increased growth of Xcv ΔxopN and Xcv ΔhrpF demonstrating that TFT1 is required to inhibit Xcv multiplication. TFT1 expression was required for Xcv-induced accumulation of PTI5, GRAS4, WRKY28, and LRR22 mRNAs, four PTI marker genes in tomato. Deletion analysis revealed that the XopN C-terminal domain (amino acids 344-733) is sufficient to bind TFT1. Removal of amino acids 605-733 disrupts XopN binding to TFT1 in plant extracts and inhibits XopN-dependent virulence in tomato, demonstrating that these residues are necessary for the XopN/TFT1 interaction. Phos-tag gel analysis and mass spectrometry showed that XopN is phosphorylated in plant extracts at serine 688 in a putative 14-3-3 recognition motif. Mutation of S688 reduced XopN's phosphorylation state but was not sufficient to inhibit binding to TFT1 or reduce XopN virulence. Mutation of S688 and two leucines (L64,L65) in XopN, however, eliminated XopN binding to TFT1 in plant extracts and XopN virulence. L64 and L65 are required for XopN to bind TARK1, a tomato atypical receptor kinase required for PTI. This suggested that TFT1 binding to XopN's C-terminal domain might be stabilized via TARK1/XopN interaction. Pull-down and BiFC analyses show that XopN promotes TARK1/TFT1 complex formation in vitro and in planta by functioning as a molecular scaffold. This is the first report showing that a type III effector targets a host 14-3-3 involved in PTI to promote bacterial pathogenesis.

    View details for DOI 10.1371/journal.ppat.1002768

    View details for Web of Science ID 000305987800038

    View details for PubMedID 22719257

    View details for PubMedCentralID PMC3375313

  • Comparative analysis of the XopD type III secretion (T3S) effector family in plant pathogenic bacteria MOLECULAR PLANT PATHOLOGY Kim, J., Taylor, K. W., Mudgett, M. B. 2011; 12 (8): 715-730

    Abstract

    XopD is a type III effector protein that is required for Xanthomonas campestris pathovar vesicatoria (Xcv) growth in tomato. It is a modular protein consisting of an N-terminal DNA-binding domain, two ethylene-responsive element binding factor-associated amphiphilic repression (EAR) transcriptional repressor motifs and a C-terminal small ubiquitin-related modifier (SUMO) protease. In tomato, XopD functions as a transcriptional repressor, resulting in the suppression of defence responses at late stages of infection. A survey of available genome sequences for phytopathogenic bacteria revealed that XopD homologues are limited to species within three genera of Proteobacteria--Xanthomonas, Acidovorax and Pseudomonas. Although the EAR motif(s) and SUMO protease domain are conserved in all XopD-like proteins, variation exists in the length and sequence identity of the N-terminal domains. Comparative analysis of the DNA sequences surrounding xopD and xopD-like genes led to revised annotation of the xopD gene. Edman degradation sequence analysis and functional complementation studies confirmed that the xopD gene from Xcv encodes a 760-amino-acid protein with a longer N-terminal domain than previously predicted. None of the XopD-like proteins studied complemented Xcv ΔxopD mutant phenotypes in tomato leaves, suggesting that the N-terminus of XopD defines functional specificity. Xcv ΔxopD strains expressing chimeric fusion proteins containing the N-terminus of XopD fused to the EAR motif(s) and SUMO protease domain of the XopD-like protein from X. campestris pathovar campestris strain B100 were fully virulent in tomato, demonstrating that the N-terminus of XopD controls specificity in tomato.

    View details for DOI 10.1111/J.1364-3703.2011.00706.X

    View details for Web of Science ID 000294562100001

    View details for PubMedID 21726373

    View details for PubMedCentralID PMC3166429

  • A New Leaf Blight of Rice Caused by Pantoea ananatis in India. Plant disease Mondal, K. K., Mani, C. n., Singh, J. n., Kim, J. G., Mudgett, M. B. 2011; 95 (12): 1582

    Abstract

    In September 2008, a new blight disease appeared on basmati rice (Oryza sativa L.) in fields in the northern states of India, including Uttar Pradesh, Haryana, and Punjab. First symptoms were water-soaked lesions at the tip of rice leaves. Lesions eventually spread down the leaf blades. Infected leaves turned light brown, exhibiting a blighted appearance. The disease was severe during the post-flowering stage. From 2008 to 2011, yellow-pigmented bacteria were consistently recovered on nutrient agar (beef extract 5 g, peptone 10 g, NaCl 5 g, and agar 20 g) from symptomatic rice leaves. The disease was thought to be caused by Xanthomonas oryzae pv. oryzae, the rice bacterial blight pathogen. However, physiological and molecular analysis of two strains (ITCC B0050 and ITCC B0055) isolated in 2008 revealed that the causal agent was the bacterium Pantoea ananatis. Colonies, raised and translucent with smooth margins, grew well within 24 h at 37°C. The bacteria are gram-negative facultative anaerobes with small rods arranged singly or in a chain of two to five cells. The bacteria are positive for catalase and indole production while negative for oxidase and alkaline reaction in malonate broth. Electron microscopy shows that the bacterial cells were 1.1 to 2.3 × 0.4 to 0.7 μm and have three to six peritrichous flagella. 16S rRNA gene sequence (1,535 nt generated by PCR with primers 5'AGAGTTTGATCATGGCTCAG3' and 5'AAGGAGGTGATCCAACCGCA3') of ITCC B0050 and ITCC B0055 (GenBank Nos. JF756690 and JF756691, respectively) share 99%-nt identity with P. ananatis (GenBank No. DQ512490.1). Biolog microbial identification analysis (version 4.2) of both strains showed similarity indices of 0.842 with P. ananatis (Biolog Inc., Hayward, CA). Pathogenicity was confirmed by employing the leaf tip clipping method to inoculate susceptible basmati rice (cv. Pusa basmati 1). Leaves were inoculated in triplicate with sterile water or a 1 × 108 CFU ml-1 suspension of each isolate in water. The artificially inoculated rice leaves produced water-soaked lesions similar to that observed during natural rice infection in the field. At 10 to 15 days postinoculation, the lesions on the inoculated leaves dried and turned from straw color to light brown. Yellow-pigmented bacteria were reisolated from the infected rice leaves and their identity was confirmed to be identical to the original strain by 16S rRNA sequence analysis and Biolog analysis. Both pathogen isolates elicited hypersensitive reaction in tobacco (Nicotiana tabacum cv. Xanthi) leaves 24 to 48 h postinoculation (1 × 108 CFU ml-1). These studies indicate that the causal agent of the newly emerged rice leaf blight disease in northern India is P. ananatis. Pantoea spp. are opportunistic pathogens documented to cause different diseases in economically important crop plants including grain discoloration of rice in China (1), leaf blight and bulb decay of onion in the United States (2), and leaf blight of rice in Korea (3). To our knowledge, this is the first report of rice leaf blight caused by P. ananatis in India. The significance of this pathogen to basmati rice production in India was not known until this report. The predominance of the disease in the major basmati-growing belts of northern India would certainly have great impact in reducing the yield potential of basmati rice. References: (1) H. Yan et al. Plant Dis. 94:482, 2010. (2) H. F. Schwartz and K. Otto. Plant Dis. 84:808, 2000. (3) H. B. Lee et al. Plant Dis. 94:1,372, 2010.

    View details for PubMedID 30731982

  • Sugar transporters for intercellular exchange and nutrition of pathogens NATURE Chen, L., Hou, B., Lalonde, S., Takanaga, H., Hartung, M. L., Qu, X., Guo, W., Kim, J., Underwood, W., Chaudhuri, B., Chermak, D., Antony, G., White, F. F., Somerville, S. C., Mudgett, M. B., Frommer, W. B. 2010; 468 (7323): 527-U199

    Abstract

    Sugar efflux transporters are essential for the maintenance of animal blood glucose levels, plant nectar production, and plant seed and pollen development. Despite broad biological importance, the identity of sugar efflux transporters has remained elusive. Using optical glucose sensors, we identified a new class of sugar transporters, named SWEETs, and show that at least six out of seventeen Arabidopsis, two out of over twenty rice and two out of seven homologues in Caenorhabditis elegans, and the single copy human protein, mediate glucose transport. Arabidopsis SWEET8 is essential for pollen viability, and the rice homologues SWEET11 and SWEET14 are specifically exploited by bacterial pathogens for virulence by means of direct binding of a bacterial effector to the SWEET promoter. Bacterial symbionts and fungal and bacterial pathogens induce the expression of different SWEET genes, indicating that the sugar efflux function of SWEET transporters is probably targeted by pathogens and symbionts for nutritional gain. The metazoan homologues may be involved in sugar efflux from intestinal, liver, epididymis and mammary cells.

    View details for DOI 10.1038/nature09606

    View details for Web of Science ID 000284584200034

    View details for PubMedID 21107422

    View details for PubMedCentralID PMC3000469

  • SOBER1 phospholipase activity suppresses phosphatidic acid accumulation and plant immunity in response to bacterial effector AvrBsT PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA Kirik, A., Mudgett, M. B. 2009; 106 (48): 20532-20537

    Abstract

    Arabidopsis thaliana ecotype Pi-0 is resistant to Pseudomonas syringae pathovar tomato (Pst) strain DC3000 expressing the T3S effector protein AvrBsT. Resistance is due to a loss of function mutation (sober1-1) in a conserved alpha/beta hydrolase, SOBER1 (Suppressor of AvrBsT Elicited Resistance1). Members of this superfamily possess phospholipase and carboxylesterase activity with diverse substrate specificity. The nature of SOBER1 enzymatic activity and substrate specificity was not known. SOBER1-dependent suppression of the hypersensitive response (HR) in Pi-0 suggested that it might hydrolyze a plant lipid or precursor required for HR induction. Here, we show that Pi-0 leaves infected with Pst DC3000 expressing AvrBsT accumulated higher levels of phosphatidic acid (PA) compared to leaves infected with Pst DC3000. Phospholipase D (PLD) activity was required for high PA levels and AvrBsT-dependent HR in Pi-0. Overexpression of SOBER1 in Pi-0 reduced PA levels and inhibited HR. These data implicated PA, phosphatidylcholine (PC) and lysophosphatidylcholine (LysoPC) as potential SOBER1 substrates. Recombinant His(6)-SOBER1 hydrolyzed PC but not PA or LysoPC in vitro indicating that the enzyme has phospholipase A(2) (PLA(2)) activity. Chemical inhibition of PLA(2) activity in leaves expressing SOBER1 resulted in HR in response to Pst DC3000 AvrBsT. These data are consistent with the model that SOBER1 PLA(2) activity suppresses PLD-dependent production of PA in response to AvrBsT elicitation. This work highlights an important role for SOBER1 in the regulation of PA levels generated in plants in response to biotic stress.

    View details for DOI 10.1073/pnas.0903859106

    View details for Web of Science ID 000272254400072

    View details for PubMedID 19918071

    View details for PubMedCentralID PMC2787154

  • Xanthomonas T3S Effector XopN Suppresses PAMP-Triggered Immunity and Interacts with a Tomato Atypical Receptor-Like Kinase and TFT1 PLANT CELL Kim, J., Li, X., Roden, J. A., Taylor, K. W., Aakre, C. D., Su, B., Lalonde, S., Kirik, A., Chen, Y., Baranage, G., McLane, H., Martin, G. B., Mudgett, M. B. 2009; 21 (4): 1305-1323

    Abstract

    XopN is a virulence factor from Xanthomonas campestris pathovar vesicatoria (Xcv) that is translocated into tomato (Solanum lycopersicum) leaf cells by the pathogen's type III secretion system. Xcv DeltaxopN mutants are impaired in growth and have reduced ability to elicit disease symptoms in susceptible tomato leaves. We show that XopN action in planta reduced pathogen-associated molecular pattern (PAMP)-induced gene expression and callose deposition in host tissue, indicating that XopN suppresses PAMP-triggered immune responses during Xcv infection. XopN is predicted to have irregular, alpha-helical repeats, suggesting multiple protein-protein interactions in planta. Consistent with this prediction, XopN interacted with the cytosolic domain of a Tomato Atypical Receptor-Like Kinase1 (TARK1) and four Tomato Fourteen-Three-Three isoforms (TFT1, TFT3, TFT5, and TFT6) in yeast. XopN/TARK1 and XopN/TFT1 interactions were confirmed in planta by bimolecular fluorescence complementation and pull-down analysis. Xcv DeltaxopN virulence defects were partially suppressed in transgenic tomato leaves with reduced TARK1 mRNA levels, indicating that TARK1 plays an important role in the outcome of Xcv-tomato interactions. These data provide the basis for a model in which XopN binds to TARK1 to interfere with TARK1-dependent signaling events triggered in response to Xcv infection.

    View details for DOI 10.1105/tpc.108.063123

    View details for Web of Science ID 000266295800025

    View details for PubMedID 19366901

    View details for PubMedCentralID PMC2685636

  • XopD SUMO protease affects host transcription, promotes pathogen growth, and delays symptom development in Xanthomonas-infected tomato leaves PLANT CELL Kim, J., Taylor, K. W., Hotson, A., Keegan, M., Schmelz, E. A., Mudgett, M. B. 2008; 20 (7): 1915-1929

    Abstract

    We demonstrate that XopD, a type III effector from Xanthomonas campestris pathovar vesicatoria (Xcv), suppresses symptom production during the late stages of infection in susceptible tomato (Solanum lycopersicum) leaves. XopD-dependent delay of tissue degeneration correlates with reduced chlorophyll loss, reduced salicylic acid levels, and changes in the mRNA abundance of senescence- and defense-associated genes despite high pathogen titers. Subsequent structure-function analyses led to the discovery that XopD is a DNA binding protein that alters host transcription. XopD contains a putative helix-loop-helix domain required for DNA binding and two conserved ERF-associated amphiphilic motifs required to repress salicylic acid- and jasmonic acid-induced gene transcription in planta. Taken together, these data reveal that XopD is a unique virulence factor in Xcv that alters host transcription, promotes pathogen multiplication, and delays the onset of leaf chlorosis and necrosis.

    View details for DOI 10.1105/tpc.108.058529

    View details for Web of Science ID 000258725600019

    View details for PubMedID 18664616

    View details for PubMedCentralID PMC2518228

  • Impact of Xanthomonas AvrBsT effector action on signaling and immunity in Arabidopsis Mudgett, M. B. AMER PHYTOPATHOLOGICAL SOC. 2008: S193
  • Blue-light-activated histidine kinases: Two-component sensors in bacteria SCIENCE Swartz, T. E., Tseng, T., Frederickson, M. A., Paris, G., Comerci, D. J., Rajashekara, G., Kim, J., Mudgett, M. B., Splitter, G. A., Ugalde, R. A., Goldbaum, F. A., Briggs, W. R., Bogomolni, R. A. 2007; 317 (5841): 1090-1093

    Abstract

    Histidine kinases, used for environmental sensing by bacterial two-component systems, are involved in regulation of bacterial gene expression, chemotaxis, phototaxis, and virulence. Flavin-containing domains function as light-sensory modules in plant and algal phototropins and in fungal blue-light receptors. We have discovered that the prokaryotes Brucella melitensis, Brucella abortus, Erythrobacter litoralis, and Pseudomonas syringae contain light-activated histidine kinases that bind a flavin chromophore and undergo photochemistry indicative of cysteinyl-flavin adduct formation. Infection of macrophages by B. abortus was stimulated by light in the wild type but was limited in photochemically inactive and null mutants, indicating that the flavin-containing histidine kinase functions as a photoreceptor regulating B. abortus virulence.

    View details for DOI 10.1126/science.1144306

    View details for Web of Science ID 000248946700047

    View details for PubMedID 17717187

  • Xanthomonas XopD TTSS effector is a repressor of hormone-induced transcriptional responses. Mudgett, M. B. AMER PHYTOPATHOLOGICAL SOC. 2007: S145
  • An alpha-amylase (At4g25000) in Arabidopsis leaves is secreted and induced by biotic and abiotic stress PLANT CELL AND ENVIRONMENT Doyle, E. A., Lane, A. M., Sides, J. M., Mudgett, M. B., Monroe, J. D. 2007; 30 (4): 388-398

    Abstract

    Leaves are reported to contain a secreted alpha-amylase that accumulates during senescence or after biotic or abiotic stress; however, a gene encoding this enzyme has not been described. Because a secreted amylase is isolated from plastidic starch, the function of this enzyme is difficult to predict, but circumstantial evidence suggests that it may degrade starch after cell death. The Arabidopsis thaliana genome contains three alpha-amylase genes, one of which, AMY1 (At4g25000), has a putative signal sequence suggesting that the protein may be secreted. Two independent T-DNA insertion mutants in AMY1 lacked an amylase band on starch zymograms, which was previously named 'A1'. Washed leaf protoplasts contained reduced A1 activity suggesting that the enzyme is secreted. Native AMY1, fused to a weakly fluorescent form of GFP, was sensitive to proteinase K infiltrated into leaf apoplastic spaces, while a cytosolic form of GFP was unaffected until cell breakage, confirming that the AMY1 protein is secreted. Amylase A1 was transcriptionally induced in senescing leaves and in leaves exposed to heat stress, treated with abscisic acid or infected with Pseudomonas syringae pv. tomato expressing avrRpm1. The A1 amylase was also extremely heat resistant and its expression was up-regulated in cpr5-2, an activated defence response mutant.

    View details for DOI 10.1111/j.1365-3040.2006.01624.x

    View details for Web of Science ID 000244419700002

    View details for PubMedID 17324226

  • A conserved carboxylesterase is a SUPPRESSOR OF AVRBST-ELICITED RESISTANCE in Arabidopsis PLANT CELL Cunnac, S., Wilson, A., Nuwer, J., Kirik, A., Baranage, G., Mudgett, M. B. 2007; 19 (2): 688-705

    Abstract

    AvrBsT is a type III effector from Xanthomonas campestris pv vesicatoria that is translocated into plant cells during infection. AvrBsT is predicted to encode a Cys protease that targets intracellular host proteins. To dissect AvrBsT function and recognition in Arabidopsis thaliana, 71 ecotypes were screened to identify lines that elicit an AvrBsT-dependent hypersensitive response (HR) after Xanthomonas campestris pv campestris (Xcc) infection. The HR was observed only in the Pi-0 ecotype infected with Xcc strain 8004 expressing AvrBsT. To create a robust pathosystem to study AvrBsT immunity in Arabidopsis, the foliar pathogen Pseudomonas syringae pv tomato (Pst) strain DC3000 was engineered to translocate AvrBsT into Arabidopsis by the Pseudomonas type III secretion (T3S) system. Pi-0 leaves infected with Pst DC3000 expressing a Pst T3S signal fused to AvrBsT-HA (AvrBsTHYB-HA) elicited HR and limited pathogen growth, confirming that the HR leads to defense. Resistance in Pi-0 is caused by a recessive mutation predicted to inactivate a carboxylesterase known to hydrolyze lysophospholipids and acylated proteins in eukaryotes. Transgenic Pi-0 plants expressing the wild-type Columbia allele are susceptible to Pst DC3000 AvrBsTHYB-HA infection. Furthermore, wild-type recombinant protein cleaves synthetic p-nitrophenyl ester substrates in vitro. These data indicate that the carboxylesterase inhibits AvrBsT-triggered phenotypes in Arabidopsis. Here, we present the cloning and characterization of the SUPPRESSOR OF AVRBST-ELICITED RESISTANCE1.

    View details for DOI 10.1105/tpc.106.048710

    View details for Web of Science ID 000245467700026

    View details for PubMedID 17293566

    View details for PubMedCentralID PMC1867326

  • Xanthomonas XopN is a HEAT-repeat protein that physically interacts with a RLK and two pathogen-inducible 14-3-3 proteins from tomato Mudgett, M. B. AMER PHYTOPATHOLOGICAL SOC. 2006: S151
  • New insights to the function of phytopathogenic bacterial type III effectors in plants ANNUAL REVIEW OF PLANT BIOLOGY Mudgett, M. B. 2005; 56: 509-531

    Abstract

    Phytopathogenic bacteria use the type III secretion system (TTSS) to inject effector proteins into plant cells. This system is essential for bacteria to multiply in plant tissue and to promote the development of disease symptoms. Until recently, little was known about the function of TTSS effectors in bacterial-plant interactions. New studies dissecting the molecular and biochemical action of TTSS effectors show that these proteins contribute to bacterial pathogenicity by interfering with plant defense signal transduction. These investigations provide us with a fresh view of how bacteria manipulate plant physiology to colonize their hosts.

    View details for DOI 10.1146/annurev.arplant.56.032604.144218

    View details for Web of Science ID 000230282800021

    View details for PubMedID 15862106

  • A genetic screen to isolate type III effectors translocated into pepper cells during Xanthomonas infection PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA Roden, J. A., Belt, B., Ross, J. B., Tachibana, T., Vargas, J., Mudgett, M. B. 2004; 101 (47): 16624-16629

    Abstract

    The bacterial pathogen Xanthomonas campestris pv. vesicatoria (Xcv) uses a type III secretion system (TTSS) to translocate effector proteins into host plant cells. The TTSS is required for Xcv colonization, yet the identity of many proteins translocated through this apparatus is not known. We used a genetic screen to functionally identify Xcv TTSS effectors. A transposon 5 (Tn5)-based transposon construct including the coding sequence for the Xcv AvrBs2 effector devoid of its TTSS signal was randomly inserted into the Xcv genome. Insertion of the avrBs2 reporter gene into Xcv genes coding for proteins containing a functional TTSS signal peptide resulted in the creation of chimeric TTSS effector::AvrBs2 fusion proteins. Xcv strains containing these fusions translocated the AvrBs2 reporter in a TTSS-dependent manner into resistant BS2 pepper cells during infection, activating the avrBs2-dependent hypersensitive response (HR). We isolated seven chimeric fusion proteins and designated the identified TTSS effectors as Xanthomonas outer proteins (Xops). Translocation of each Xop was confirmed by using the calmodulin-dependent adenylate cydase reporter assay. Three xop genes are Xanthomonas spp.-specific, whereas homologs for the rest are found in other phytopathogenic bacteria. XopF1 and XopF2 define an effector gene family in Xcv. XopN contains a eukaryotic protein fold repeat and is required for full Xcv pathogenicity in pepper and tomato. The translocated effectors identified in this work expand our knowledge of the diversity of proteins that Xcv uses to manipulate its hosts.

    View details for DOI 10.1073/pnas.0407383101

    View details for Web of Science ID 000225347400045

    View details for PubMedID 15545602

    View details for PubMedCentralID PMC534543

  • Cysteine proteases in phytopathogenic bacteria: identification of plant targets and activation of innate immunity CURRENT OPINION IN PLANT BIOLOGY Hotson, A., Mudgett, M. B. 2004; 7 (4): 384-390

    Abstract

    Phytopathogenic bacteria use the type-III secretion system (TTSS) to inject effector proteins into plant cells, presumably to colonize their hosts. The function of these proteins inside plant cells has remained a mystery for years. The recent discovery that the effectors XopD, AvrXv4, AvrPphB, and AvrRpt2 have cysteine protease functions reveals that the proteolysis of host substrates is an important strategy employed by pathogens to alter plant physiology. Moreover, the characterization of these proteases and their targets provides new insight to mechanisms of bacterial virulence and the activation of plant immunity.

    View details for DOI 10.1016/j.pbi.2004.05.003

    View details for Web of Science ID 000222787200006

    View details for PubMedID 15231260

  • Characterization of the Xanthomonas AvrXv4 effector, a SUMO protease translocated into plant cells MOLECULAR PLANT-MICROBE INTERACTIONS Roden, J., Eardley, L., Hotson, A., Cao, Y. Y., Mudgett, M. B. 2004; 17 (6): 633-643

    Abstract

    Homologs of the Yersinia virulence factor YopJ are found in both animal and plant bacterial pathogens, as well as in plant symbionts. The conservation of this effector family indicates that several pathogens may use YopJ-like proteins to regulate bacteria-host interactions during infection. YopJ and YopJ-like proteins share structural homology with cysteine proteases and are hypothesized to functionally mimic small ubiquitin-like modifier (SUMO) proteases in eukaryotic cells. Strains of the phytopathogenic bacterium Xanthomonas campestris pv. vesicatoria are known to possess four YopJ-like proteins, AvrXv4, AvrBsT, AvrRxv, and XopJ. In this work, we have characterized AvrXv4 to determine if AvrXv4 functions like a SUMO protease in planta during Xanthomonas-plant interactions. We provide evidence that X. campestris pv. vesicatoria secretes and translocates the AvrXv4 protein into plant cells during infection in a type III-dependent manner. Once inside the plant cell, AvrXv4 is localized to the plant cytoplasm. By performing AvrXv4 deletion and mutational analysis, we have identified amino acids required for type III delivery and for host recognition. We show that AvrXv4 recognition by resistant plants requires a functional protease catalytic core, the domain that is conserved in all of the putative YopJ-like cysteine proteases. We also show that AvrXv4 expression in planta leads to a reduction in SUMO-modified proteins, demonstrating that AvrXv4 possesses SUMO isopeptidase activity. Overall, our studies reveal that the YopJ-like effector AvrXv4 encodes a type III SUMO protease effector that is active in the cytoplasmic compartment of plant cells.

    View details for Web of Science ID 000221537300008

    View details for PubMedID 15195946

  • Importance of opgH(Xcv) of Xanthomonas campestris pv. vesicatoria in host-parasite interactions MOLECULAR PLANT-MICROBE INTERACTIONS Minsavage, G. V., Mudgett, M. B., Stall, R. E., Jones, J. B. 2004; 17 (2): 152-161

    Abstract

    Tn5 insertion mutants of Xanthomonas campestris pv. vesicatoria were inoculated into tomato and screened for reduced virulence. One mutant exhibited reduced aggressiveness and attenuated growth in planta. Southern blot analyses indicated that the mutant carried a single Tn5 insertion not associated with previously cloned pathogenicity-related genes of X. campestris pv. vesicatoria. The wild-type phenotype of this mutant was restored by one recombinant plasmid (pOPG361) selected from a genomic library of X. campestris pv. vesicatoria 91-118. Tn3-gus insertion mutagenesis and sequence analyses of a subclone of pOPG361 identified a 1,929-bp open reading frame (ORF) essential for complementation of the mutants. The predicted protein encoded by this ORF was highly homologous to the previously reported pathogenicity-related HrpM protein of Pseudomonas syringae pv. syringae and OpgH of Erwinia chrysanthemi. Based on homology, the new locus was designated opgHXcv. Manipulation of the osmotic potential in the intercellular spaces of tomato leaves by addition of mannitol at low concentrations (25 to 50 mM) compensates for the opgHXcv mutation.

    View details for Web of Science ID 000220329400003

    View details for PubMedID 14964529

  • Xanthomonas type III effector XopD targets SUMO-conjugated proteins in planta MOLECULAR MICROBIOLOGY Hotson, A., Chosed, R., Shu, H. J., Orth, K., Mudgett, M. B. 2003; 50 (2): 377-389

    Abstract

    Xanthomonas campestris pathovar vesicatoria (Xcv) uses the type III secretion system (TTSS) to inject effector proteins into cells of Solanaceous plants during pathogenesis. A number of Xcv TTSS effectors have been identified; however, their function in planta remains elusive. Here, we provide direct evidence for a functional role for a phytopathogenic bacterial TTSS effector in planta by demonstrating that the Xcv effector XopD encodes an active cysteine protease with plant-specific SUMO substrate specificity. XopD is injected into plant cells by the TTSS during Xcv pathogenesis, translocated to subnuclear foci and hydrolyses SUMO-conjugated proteins in vivo. Our studies suggest that XopD mimics endogenous plant SUMO isopeptidases to interfere with the regulation of host proteins during Xcv infection.

    View details for DOI 10.1046/j.1365-2958.2003.03730.x

    View details for Web of Science ID 000185961100003

    View details for PubMedID 14617166

  • Common and contrasting themes of plant and animal diseases SCIENCE Staskawicz, B. J., Mudgett, M. B., Dangl, J. L., Galan, J. E. 2001; 292 (5525): 2285-2289

    Abstract

    Recent studies in bacterial pathogenesis reveal common and contrasting mechanisms of pathogen virulence and host resistance in plant and animal diseases. This review presents recent developments in the study of plant and animal pathogenesis, with respect to bacterial colonization and the delivery of effector proteins to the host. Furthermore, host defense responses in both plants and animals are discussed in relation to mechanisms of pathogen recognition and defense signaling. Future studies will greatly add to our understanding of the molecular events defining host-pathogen interactions.

    View details for Web of Science ID 000169455900045

    View details for PubMedID 11423652

  • Mutational analysis of the Arabidopsis RPS2 disease resistance gene and the corresponding Pseudomonas syringae avrRpt2 avirulence gene MOLECULAR PLANT-MICROBE INTERACTIONS Axtell, M. J., McNellis, T. W., Mudgett, M. B., Hsu, C. S., Staskawicz, B. J. 2001; 14 (2): 181-188

    Abstract

    Plants have evolved a large number of disease resistance genes that encode proteins containing conserved structural motifs that function to recognize pathogen signals and to initiate defense responses. The Arabidopsis RPS2 gene encodes a protein representative of the nucleotide-binding site-leucine-rich repeat (NBS-LRR) class of plant resistance proteins. RPS2 specifically recognizes Pseudomonas syringae pv. tomato strains expressing the avrRpt2 gene and initiates defense responses to bacteria carrying avrRpt2, including a hypersensitive cell death response (HR). We present an in planta mutagenesis experiment that resulted in the isolation of a series of rps2 and avrRpt2 alleles that disrupt the RPS2-avrRpt2 gene-for-gene interaction. Seven novel avrRpt2 alleles incapable of eliciting an RPS2-dependent HR all encode proteins with lesions in the C-terminal portion of AvrRpt2 previously shown to be sufficient for RPS2 recognition. Ten novel rps2 alleles were characterized with mutations in the NBS and the LRR. Several of these alleles code for point mutations in motifs that are conserved among NBS-LRR resistance genes, including the third LRR, which suggests the importance of these motifs for resistance gene function.

    View details for Web of Science ID 000166511100009

    View details for PubMedID 11204781

  • Disruption of signaling by Yersinia effector YopJ, a ubiquitin-like protein protease SCIENCE Orth, K., Xu, Z. H., Mudgett, M. B., Bao, Z. Q., Palmer, L. E., Bliska, J. B., Mangel, W. F., Staskawicz, B., Dixon, J. E. 2000; 290 (5496): 1594-1597

    Abstract

    Homologs of the Yersinia virulence effector YopJ are found in both plant and animal bacterial pathogens, as well as plant symbionts. These YopJ family members were shown to act as cysteine proteases. The catalytic triad of the protease was required for inhibition of the mitogen-activated protein kinase (MAPK) and nuclear factor kappaB (NF-kappaB) signaling in animal cells and for induction of localized cell death in plants. The substrates for YopJ were shown to be highly conserved ubiquitin-like molecules, which are covalently added to numerous regulatory proteins. YopJ family members exert their pathogenic effect on cells by disrupting this posttranslational modification.

    View details for Web of Science ID 000165446200056

    View details for PubMedID 11090361

  • Molecular signals required for type III secretion and translocation of the Xanthomonas campestris AvrBs2 protein to pepper plants PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA Mudgett, M. B., Chesnokova, O., Dahlbeck, D., Clark, E. T., Rossier, O., Bonas, U., Staskawicz, B. J. 2000; 97 (24): 13324-13329

    Abstract

    Strains of Xanthomonas campestris pv. vesicatoria (Xcv) carrying avrBs2 are specifically recognized by Bs2 pepper plants, resulting in localized cell death and plant resistance. Agrobacterium-mediated transient expression of the Xcv avrBs2 gene in plant cells results in Bs2-dependent cell death, indicating that the AvrBs2 protein alone is sufficient for the activation of disease resistance-mediated cell death in planta. We now provide evidence that AvrBs2 is secreted from Xcv and that secretion is type III (hrp) dependent. N- and C-terminal deletion analysis of AvrBs2 has identified the effector domain of AvrBs2 recognized by Bs2 pepper plants. By using a truncated Pseudomonas syringae AvrRpt2 effector reporter devoid of type III signal sequences, we have localized the minimal region of AvrBs2 required for type III secretion in Xcv. Furthermore, we have identified the region of AvrBs2 required for both type III secretion and translocation to host plants. The mapping of AvrBs2 sequences sufficient for type III delivery also revealed the presence of a potential mRNA secretion signal.

    View details for Web of Science ID 000165476300077

    View details for PubMedID 11078519

  • Molecular Characterization of the avrBs2 gene of Xanthomonas campestris pv. vesicatoria and the Bs2 gene of pepper 9th International Congress on Molecular Plant-Microbe Interactions Tai, T., Dahlbeck, D., Gassmann, W., Chesnokova, O., Whalen, M., Clark, E., Mudgett, M. B., Staskawicz, B. INTERNATIONAL SOC MOLECULAR PLANT-MICROBE INTERACTIONS. 2000: 223–226
  • Characterization of the Pseudomonas syringae pv. tomato AvrRpt2 protein: demonstration of secretion and processing during bacterial pathogenesis MOLECULAR MICROBIOLOGY Mudgett, M. B., Staskawicz, B. J. 1999; 32 (5): 927-941

    Abstract

    Pseudomonas syringae pv. tomato strain DC3000 (Pst DC3000) expressing avrRpt2 is specifically recognized by plant cells expressing RPS2 activity, resulting in localized cell death and plant resistance. Furthermore, transient expression of this bacterial avrRpt2 gene in plant cells results in RPS2-dependent cell death. This indicates that the AvrRpt2 protein is recognized inside RPS2 plant cells and is sufficient for the activation of disease resistance-mediated cell death in planta. We explored the possibility that Pst DC3000 delivers AvrRpt2 protein to plant cells via the hrp (type III) secretion pathway. We now provide direct evidence that mature AvrRpt2 protein is secreted from Pst DC3000 and that secretion is hrp dependent. We also show that AvrRpt2 is N-terminally processed when Arabidopsis thaliana plants are infected with Pst DC3000 expressing avrRpt2. Similar N-terminal processing of AvrRpt2 occurred when avrRpt2 was stably expressed in A. thaliana. No cleavage of AvrRpt2 was detected in bacteria expressing avrRpt2 in culture or in the plant extracellular fluids. The N-terminus of AvrRpt2 was not required for RPS2 recognition in planta. However, this region of AvrRpt2 was essential for Pst DC3000-mediated elicitation of RPS2-dependent cell death in A. thaliana leaves.

    View details for Web of Science ID 000081027300004

    View details for PubMedID 10361296

  • Glucocorticoid-inducible expression of a bacterial avirulence gene in transgenic Arabidopsis induces hypersensitive cell death PLANT JOURNAL McNellis, T. W., Mudgett, M. B., Li, K., Aoyama, T., Horvath, D., Chua, N. H., Staskawicz, B. J. 1998; 14 (2): 247-257

    Abstract

    Pathogenic strains of Pseudomonas syringae pv. tomato carrying the avrRpt2 avirulence gene specifically induce a hypersensitive cell death response in Arabidopsis plants that contain the complementary RPS2 disease resistance gene. Transient expression of avrRpt2 in Arabidopsis plants having the RPS2 gene has been shown to induce hypersensitive cell death. In order to analyze the effects of conditional expression of avrRpt2 in Arabidopsis plants, transgenic lines were constructed that contained the avrRpt2 gene under the control of a tightly regulated, glucocorticoid-inducible promoter. Dexamethasone-induced expression of avrRpt2 in transgenic lines having the RPS2 gene resulted in a specific hypersensitive cell death response that resembled a Pseudomonas syringae-induced hypersensitive response and also induced the expression of a pathogenesis-related gene (PR1). Interestingly, high level expression of avrRpt2 in a mutant rps2-101C background resulted in plant stress and ultimately cell death, suggesting a possible role for avrRpt2 in Pseudomonas syringae virulence. Transgenic RPS2 and rps2 plants that contain the glucocorticoid-inducible avrRpt2 gene will provide a powerful new tool for the genetic, physiological, biochemical, and molecular dissection of an avirulence gene-specified cell death response in both resistant and susceptible plants.

    View details for Web of Science ID 000073794300012

    View details for PubMedID 9628020

  • Protein signaling via type III secretion pathways in phytopathogenic bacteria CURRENT OPINION IN MICROBIOLOGY Mudgett, M. B., Staskawicz, B. J. 1998; 1 (1): 109-115

    Abstract

    Progress in the genetic and biochemical dissection of the hrp-encoded type III secretion pathway has revealed new mechanisms by which phytopathogenic bacteria infect plants. The suggestion that bacterial gene products are 'delivered to' and 'perceived by' plants cells has fundamentally changed the way in which plant-bacterial interactions are now being viewed.

    View details for Web of Science ID 000075765000016

    View details for PubMedID 10438234

  • Protein repair L-isoaspartyl methyltransferase in plants - Phylogenetic distribution and the accumulation of substrate proteins in aged barley seeds PLANT PHYSIOLOGY Mudgett, M. B., Lowenson, J. D., Clarke, S. 1997; 115 (4): 1481-1489

    Abstract

    Protein L-isoaspartate (D-aspartate) O-methyltransferases (MTs; EC 2.1.1.77) can initiate the conversion of detrimental L-isoaspartyl residues in spontaneously damaged proteins to normal L-aspartyl residues. We detected this enzyme in 45 species from 23 families representing most of the divisions of the plant kingdom. MT activity is often localized in seeds, suggesting that it has a role in their maturation, quiescence, and germination. The relationship among MT activity, the accumulation of abnormal protein L-isoaspartyl residues, and seed viability was explored in barley (Hordeum vulgare cultivar Himalaya) seeds, which contain high levels of MT. Natural aging of barley seeds for 17 years resulted in a significant reduction in MT activity and in seed viability, coupled with increased levels of "unrepaired" L-isoaspartyl residues. In seeds heated to accelerate aging, we found no reduction of MT activity, but we did observe decreased seed viability and the accumulation of isoaspartyl residues. Among populations of accelerated aged seed, those possessing the highest levels of L-isoaspartyl-containing proteins had the lowest germination percentages. These results suggest that the MT present in seeds cannot efficiently repair all spontaneously damaged proteins containing altered aspartyl residues, and their accumulation during aging may contribute to the loss of seed viability.

    View details for Web of Science ID 000071040500020

    View details for PubMedID 9414558

  • A distinctly regulated protein repair L-isoaspartylmethyltransferase from Arabidopsis thaliana PLANT MOLECULAR BIOLOGY Mudgett, M. B., Clarke, S. 1996; 30 (4): 723-737

    Abstract

    Protein-L-isoaspartate (D-aspartate) O-methyltransferases (EC 2.1.1.77) that catalyze the transfer of methyl groups from S-adenosylmethionine to abnormal L-isoaspartyl and D-aspartyl residues in a variety of peptides and proteins are widely distributed in procaryotes and eucaryotes. These enzymes participate in the repair of spontaneous protein damage by facilitating the conversion of L-isoaspartyl and D-aspartyl residues to normal L-aspartyl residues. In this work, we have identified an L-isoaspartyl methyltransferase activity in Arabidopsis thaliana, a dicotyledonous plant of the mustard family. The highest levels of activity were detected in seeds. Using degenerate oligonucleotides corresponding to two highly conserved amino acid regions shared among the Escherichia coli, wheat, and human enzymes, we isolated and sequenced a full-length genomic clone encoding the A. thaliana methyltransferase. Several methyltransferase cDNAs were also characterized, including ones that would encode full-length polypeptides of 230 amino acid residues. Messenger RNAs for the A. thaliana enzyme were found in a variety of tissues that did not contain significant amounts of active enzyme suggesting the possibility of translational or posttranslational controls on methyltransferase levels. We have identified a putative abscisic acid-response element (ABRE) in the 5'-untranslated region of the A. thaliana L-isoaspartyl methyltransferase gene and have shown that the expression of the mRNA is responsive to exogenous abscisic acid (ABA), but not to the environmental stresses of salt or drought. The expression of the A. thaliana enzyme appears to be regulated in a distinct fashion from that seen in wheat or in animal tissues.

    View details for Web of Science ID A1996UE16500004

    View details for PubMedID 8624405

  • EXCEPTIONAL SEED LONGEVITY AND ROBUST GROWTH - ANCIENT SACRED LOTUS FROM CHINA AMERICAN JOURNAL OF BOTANY SHENMILLER, J., Mudgett, M. B., Schopf, J. W., Clarke, S., Berger, R. 1995; 82 (11): 1367-1380
  • HORMONAL AND ENVIRONMENTAL RESPONSIVENESS OF A DEVELOPMENTALLY-REGULATED PROTEIN REPAIR L-ISOASPARTYL METHYLTRANSFERASE IN WHEAT JOURNAL OF BIOLOGICAL CHEMISTRY Mudgett, M. B., Clarke, S. 1994; 269 (41): 25605-25612

    Abstract

    The L-isoaspartyl protein methyltransferase (EC 2.1.1.77) has been proposed to be involved in the repair of spontaneously damaged proteins by facilitating the conversion of abnormal L-isoaspartyl residues to normal L-aspartyl residues. Based on the abundance of this enzyme in the seeds of a variety of plants and its unique substrate specificity, it has been hypothesized that it functions to prevent the accumulation of abnormal aspartyl residues in the proteins of aging seeds that can limit the viability of the embryo or its chances for germination. In this work, we show that the expression of the L-isoaspartyl methyltransferase is under developmental regulation in the winter wheat, Triticum aestivum. Methyltransferase mRNA and active enzyme are first detected in seeds during the late stages (III-IV) of caryopsis development. As mature seeds germinate, methyltransferase mRNA levels decline and are nearly undetectable by 72 h post-imbibition. Enzyme activity remains constant for 24 h post-imbibition and then decreases rapidly following the reduction of its corresponding mRNA. Methyltransferase activity is very low or undetectable in wheat seedlings, including leaf and root tissues. We show, however, that the L-isoaspartyl methyltransferase can be induced in vegetative tissues in response to hormone treatment and environmental stress. Abscisic acid, a phytohormone involved in seed development and desiccation tolerance, induces both methyltransferase mRNA and enzyme activity in 4-day-old wheat seedlings. Dehydration and salt stress also induce its transcription and enzymatic activity in seedlings. The ability of a plant to regulate methyltransferase activity in its seeds and vegetative tissues in response to desiccation, aging, and environmental stress may allow the plant to efficiently repair protein damage associated with these physiological changes.

    View details for Web of Science ID A1994PQ49100059

    View details for PubMedID 7929264

  • CHARACTERIZATION OF PLANT L-ISOASPARTYL METHYLTRANSFERASES THAT MAY BE INVOLVED IN SEED SURVIVAL - PURIFICATION, CLONING, AND SEQUENCE-ANALYSIS OF THE WHEAT-GERM ENZYME BIOCHEMISTRY Mudgett, M. B., Clarke, S. 1993; 32 (41): 11100-11111

    Abstract

    Protein carboxyl methyltransferases (EC 2.1.1.77) that catalyze the transfer of a methyl group from S-adenosylmethionine to L-isoaspartyl and D-aspartyl residues in a variety of peptides and proteins are widely, but not universally, distributed in nature. These enzymes can participate in the repair of damaged proteins by facilitating the conversion of abnormal L-isoaspartyl residues to normal L-aspartyl residues. In this work, we have identified L-isoaspartyl methyltransferase activity in a variety of higher plant species and a green alga. Interestingly, the highest levels of methyltransferase were located in seeds, where the problem of spontaneous protein degradation may become particularly severe upon aging. The wheat germ methyltransferase was purified as a monomeric 28,000-Da species by DEAE-cellulose chromatography, reverse ammonium sulfate gradient solubilization, and gel filtration chromatography. The purified enzyme recognized a variety of L-isoaspartyl-containing peptides, but did not recognize two D-aspartyl-containing peptides that are substrates for the mammalian enzyme. The partial amino acid sequence was utilized to design oligonucleotides to isolate a full-length cDNA clone, pMBM1. Its nucleotide sequence demonstrated an open reading frame encoding a polypeptide of 230 amino acid residues with a calculated molecular weight of 24,710. This sequence shares 31% identity with the L-isoaspartyl methyltransferase from Escherichia coli and 50% identity with the L-isoaspartyl/D-aspartyl methyltransferase from human erythrocytes. Such conservation in sequence is consistent with a fundamental role of this enzyme in the metabolism of spontaneously damaged polypeptides.

    View details for Web of Science ID A1993MC56900019

    View details for PubMedID 8198620