Academic Appointments


Administrative Appointments


  • Member, Editorial Board, Proceedings of the National Academies of Science (2017 - Present)
  • Editor, Biophysical Journal (2014 - Present)
  • Member, Advisory Editorial Board, EMBO reports (2011 - Present)
  • Editor, Structure (2007 - Present)
  • Chair, Dept of Structural Biology, Stanford University School of Medicine (2004 - 2014)
  • Associate Chair, Dept of Structural Biology, Stanford University School of Medicine (1997 - 2004)
  • Director, Stanford Magnetic Resonance Laboratory, Stanford University School of Medicine (1997 - Present)
  • Member, Postdoctoral Affairs Committee, Stanford University School of Medicine (2001 - 2002)
  • Chair, Postdoctoral Affairs Committee, Stanford University School of Medicine (2002 - 2005)
  • Member, NIH BBCA Study Section (2003 - 2007)
  • Senior Editor, Structure (2003 - 2007)
  • Director, Int'l School of Biological Magnetic Resonance, EMFCSC, Erice, Italy (2003 - Present)
  • Chair, Provost's Advisory Board for Postdoctoral Affairs, Stanford University (2005 - 2008)
  • Chair, University Committee on Postdoctoral Affairs, Stanford University (2008 - 2009)

Honors & Awards


  • Member, National Academy of Sciences (2014)
  • Merit Award, NIH (2011)
  • NIH Director's Transformative R01 (T-R01) Program Award, NIH (2011)
  • Alfred P. Sloan Research Fellow, Alfred P. Sloan Research Foundation (1997)
  • David and Lucille Packard Fellow, David and Lucille Packard Fellowship in Science and Engineering (1994-99)
  • Teacher Scholar, Camille and Henry Dreyfus Teacher Scholar Award (1993)

Boards, Advisory Committees, Professional Organizations


  • Council member, Biophysical Society (2014 - 2017)

Professional Education


  • Ph.D., Univ of California, Berkeley, Biophysical Chemistry (1989)
  • B.A., The Johns Hopkins University, Chemistry (1984)

Community and International Work


  • ISBMR, 16th Course: Frontiers of Biophysics, Erice, Sicily, Italy

    Partnering Organization(s)

    Int'l School of Biological Magnetic Resonance (ISBMR)

    Populations Served

    Graduate Students & Postdoctoral Fellows

    Location

    International

    Ongoing Project

    No

    Opportunities for Student Involvement

    Yes

  • ISBMR, 15th Course: Biophysics and Molecular Structure, 20-28 May 2017, Erice, Sicily

    Populations Served

    postdoctoral researchers and graduate students

    Location

    International

    Ongoing Project

    Yes

    Opportunities for Student Involvement

    No

  • ISBMR, 14th Course: Future of Molecular Biophysics, 7-17 May 2016, Erice-Sicily, Italy

    Populations Served

    Graduate Students and Postdoctoral Scholars

    Location

    International

    Ongoing Project

    No

    Opportunities for Student Involvement

    Yes

  • ISBMR, 13th Course: Future of Biophysics and Structural Biology, 31 Jul-9 Aug 2014, Erice-Sicily, Italy

    Populations Served

    Graduate Students and Postdoctoral Scholars

    Location

    International

    Ongoing Project

    No

    Opportunities for Student Involvement

    Yes

  • ISBMR, 12th Course: Future of Biophysics, 9-19 June 2013, Erice-Sicily, Italy

    Topic

    NMR; Biophysics; Structural Biology; Biochemistry; X-ray Crystallography; Computational Biology

    Partnering Organization(s)

    NSF; EMFCSC

    Populations Served

    Graduate Students and Postdoctoral Scholars

    Location

    International

    Ongoing Project

    No

    Opportunities for Student Involvement

    Yes

  • ISBMR, 11th Course: Frontiers of Biophysics and Structural Biology, 11-21 June 2012, Erice-Sicily, Italy

    Topic

    NMR; Biophysics; Structural Biology; Biochemistry; X-ray Crystallography; Computational Biology

    Partnering Organization(s)

    NSF; EMFCSC; Russian Academy of Sciences

    Populations Served

    Graduate Students and Postdoctoral Scholars

    Location

    International

    Ongoing Project

    No

    Opportunities for Student Involvement

    Yes

  • ISBMR, 10th Course: Biophysics and Structure to Counter Threats and Challenges, 22 June-2 July 2010, Erice-Sicily, Italy

    Topic

    NMR; Biophysics; Structural Biology; Biochemistry; X-ray Crystallography; Computational Biology

    Partnering Organization(s)

    NATO; NSF; EMFCSC; Russian Academy of Sciences

    Populations Served

    Graduate Students and Postdoctoral Scholars

    Location

    International

    Ongoing Project

    No

    Opportunities for Student Involvement

    Yes

  • ISBMR, 9th Course: Biophysics and Structure, 22 June-2 July 2009, Erice-Sicily, Italy

    Topic

    NMR; Biophysics; Structural Biology; Biochemistry; X-ray Crystallography; Computational Biology

    Partnering Organization(s)

    NATO; NSF; EMFCSC; Russian Academy of Sciences

    Populations Served

    Graduate Students and Postdoctoral Fellows

    Location

    International

    Ongoing Project

    No

    Opportunities for Student Involvement

    Yes

  • ISBMR, 8th Course: Biophysics and the Challenges of Emerging Threats, 19-30 June 2007, Erice-Sicily, Italy

    Topic

    NMR spectroscopy; X-ray diffraction; Ribosome structure; Single-molecule methods

    Partnering Organization(s)

    NATO, NSF, Russian Academy of Sciences

    Populations Served

    Graduate Students and Postdoctoral Scholars

    Location

    International

    Ongoing Project

    No

    Opportunities for Student Involvement

    Yes

  • ISBMR, 7th Course: Structure & Biophysics, 22 Jun-3 Jul 2005, Erice-Sicily, Italy

    Topic

    NMR Principles; X-ray diffraction; Single-molecule analysis of biomolecules; Protein folding

    Partnering Organization(s)

    NATO, NSF, Russian Academy of Sciences

    Populations Served

    Grad Students and Postdoctoral Fellows

    Location

    International

    Ongoing Project

    No

    Opportunities for Student Involvement

    Yes

  • ISBMR, 6th Course: Structure, Dynamics, & Function of Biological Macromolecules, 10-22 July 2003, Erice-Sicily, Italy

    Topic

    NMR Spectroscopy; X-ray Crystallography; Molecular Dynamics; Single-molecule fluorescence

    Partnering Organization(s)

    NATO, NSF, Russian Academy of Sciences

    Populations Served

    Grad Students and Postdoctoral Fellows

    Location

    International

    Ongoing Project

    No

    Opportunities for Student Involvement

    Yes

  • ISBMR, 5th Course: Protein Structure, Dynamics, Genomics and Function, 5-15 June 2001, Erice

    Topic

    X-ray Crystallography; High Resolution NMR; Molecular Dynamics

    Partnering Organization(s)

    NATO; NSF

    Populations Served

    Graduate Students and Postdoctoral Fellows

    Location

    International

    Ongoing Project

    No

    Opportunities for Student Involvement

    Yes

Current Research and Scholarly Interests


The Puglisi group investigates the role of RNA in cellular processes and disease. Our goal is to understand RNA function in terms of molecular structure and dynamics using a variety of biophysical and biological tools. We use nuclear magnetic resonance (NMR) spectroscopy to determine structures of biological molecules, and integrate structural understanding into further mechanistic and functional studies. We investigate dynamics using single-molecule approaches. Our goal is a unified picture of structure, dynamics and function. We are currently focused on the mechanism and regulation of translation, and the role of RNA in viral infections. A long-term goal is to target processes involving RNA with novel therapeutic strategies.

2025-26 Courses


Stanford Advisees


All Publications


  • Dynamic remodeling of long-range flavivirus RNA interactions in translation initiation Palo, M. Z., Alvarado, C., Puglisi, J. D., Puglisi, E. CELL PRESS. 2026: 388a
  • Investigating the role of RRBP1 in dengue viral RNA localization and protein translation Lee, J., Palo, M., Puglisi, E., Puglisi, J. CELL PRESS. 2026: 57a
  • eIF1 and eIF5 dynamically control translation start site fidelity. Nature structural & molecular biology Grosely, R., Alvarado, C., Ivanov, I. P., Nicholson, O. B., Puglisi, J. D., Dever, T. E., Lapointe, C. P. 2025

    Abstract

    Human translation initiation requires accurate recognition of translation start sites. While AUG codons are canonical start sites, non-AUG codons are also used, typically with lower efficiency. The initiator tRNA and initiation factors eIF1 and eIF5 control recognition. How they distinguish different start sites yet allow flexible recognition remains unclear. Here we used real-time single-molecule assays and an in vitro reconstituted human system to reveal how eIF1 and eIF5 direct start site selection. eIF1 binds initiation complexes in two modes: stable binding during scanning, followed by transient, concentration-dependent rebinding after start site recognition. Termination of eIF1 rebinding requires transient and concentration-dependent binding by eIF5, which allows the formation of translation competent ribosomes. Non-AUG start sites differentially stabilize eIF1 and destabilize eIF5 binding, blocking initiation at multiple points. We confirmed these opposing effects in human cells. Collectively, our findings uncover that eIF1 and eIF5 directly compete to bind initiation complexes and illuminate how their dynamic interplay tunes the fidelity of start site recognition, which has broad connections to health and disease.

    View details for DOI 10.1038/s41594-025-01629-y

    View details for PubMedID 40721534

    View details for PubMedCentralID 363659

  • Conserved long-range interactions are required for stable folding of orthoflaviviral genomic RNA. Nucleic acids research Palo, M. Z., Ha, B., Lapointe, C. P., Alvarado, C., Janetzko, J., Carette, J. E., Puglisi, J. D., Puglisi, E. V. 2025; 53 (11)

    Abstract

    Long-range tertiary interactions are a widespread structural feature in viral RNAs (vRNAs) and mRNAs. In the orthoflaviviruses, conserved complementary sequences in the 5' and 3' terminal regions have an essential role in viral replication. Long-range pairing of these conserved sequences is proposed to facilitate a switch between two alternative vRNA conformations. Yet the detailed nature of these interactions, their relative populations and their exchange are required to formulate a mechanistic model of their role in regulation of the viral life cycle. Here, we used single-molecule Förster resonance energy transfer to study the global conformation of vRNAs by measuring their end-to-end distances. We observed that vRNA conformation is heterogeneous, and that conformers with close end-to-end distances have unusual kinetic stability when compared with mRNA lacking these specific long-range interactions. vRNAs also partition between at least two stable states with a large rearrangement of the terminal regions (>50 Å change in end-to-end distance). We demonstrate that this bistability depends on long-range interactions and is modulated by host factors such as the initiation factor complex eIF4F. Understanding how vRNA and its stability is influenced by interactions with other host and viral factors will help to elucidate a mechanistic role for these highly conserved orthoflaviviral sequences.

    View details for DOI 10.1093/nar/gkaf514

    View details for PubMedID 40521663

    View details for PubMedCentralID PMC12168079

  • Taming the ribosome. Biophysical journal Puglisi, J. D. 2024

    View details for DOI 10.1016/j.bpj.2024.07.045

    View details for PubMedID 39097772

  • eIF1 and eIF5 dynamically control translation start site fidelity. bioRxiv : the preprint server for biology Grosely, R., Alvarado, C., Ivanov, I. P., Nicholson, O. B., Puglisi, J. D., Dever, T. E., Lapointe, C. P. 2024

    Abstract

    Translation initiation defines the identity of a synthesized protein through selection of a translation start site on a messenger RNA. This process is essential to well-controlled protein synthesis, modulated by stress responses, and dysregulated in many human diseases. The eukaryotic initiation factors eIF1 and eIF5 interact with the initiator methionyl-tRNAi Met on the 40S ribosomal subunit to coordinate start site selection. Here, using single-molecule analysis of in vitro reconstituted human initiation combined with translation assays in cells, we examine eIF1 and eIF5 function. During translation initiation on a panel of RNAs, we monitored both proteins directly and in real time using single-molecule fluorescence. As expected, eIF1 loaded onto mRNAs as a component of the 43S initiation complex. Rapid (~ 2 s) eIF1 departure required a translation start site and was delayed by alternative start sites and a longer 5' untranslated region (5'UTR). After its initial departure, eIF1 rapidly and transiently sampled initiation complexes, with more prolonged sampling events on alternative start sites. By contrast, eIF5 only transiently bound initiation complexes late in initiation immediately prior to association of eIF5B, which allowed joining of the 60S ribosomal subunit. eIF5 association required the presence of a translation start site and was inhibited and destabilized by alternative start sites. Using both knockdown and overexpression experiments in human cells, we validated that eIF1 and eIF5 have opposing roles during initiation. Collectively, our findings demonstrate how multiple eIF1 and eIF5 binding events control start-site selection fidelity throughout initiation, which is tuned in response to changes in the levels of both proteins.

    View details for DOI 10.1101/2024.07.10.602410

    View details for PubMedID 39026837

    View details for PubMedCentralID PMC11257575

  • Long-range RNA interactions in flavivirus replication Palo, M. Z., Ha, B., Lapointe, C., Alvarado, C., Puglisi, J. D., Puglisi, E. CELL PRESS. 2024: 85A
  • A novel tRNA feature found in an archaeal pyrrolysyl tRNA is a requirement for PylRS recognition Zhang, J., Krahn, N., Melnikov, S. V., Tharp, J. M., Villa, A., Patel, A., Howard, R. J., Gabir, H., Patel, T. R., Stetefeld, J., Puglisi, J. D., Soll, D. CELL PRESS. 2024: 181A
  • Role of human PABPC1 in canonical and viral translation initiation Lim, K., Palo, M. Z., Puglisi, J. D., Puglisi, E. CELL PRESS. 2024: 362A
  • Impacts of HIV-1 5′ UTR structure on mRNA translation initiation Stackhouse, C. I., Jackson, L. N., Alvarado, C., Grosely, R., Puglisi, J. D., Puglisi, E. CELL PRESS. 2024: 360A-361A
  • N6-methyladenosine in 5' UTR does not promote translation initiation. Molecular cell Guca, E., Alarcon, R., Palo, M. Z., Santos, L., Alonso-Gil, S., Davyt, M., de Lima, L. H., Boissier, F., Das, S., Zagrovic, B., Puglisi, J. D., Hashem, Y., Ignatova, Z. 2024

    Abstract

    The most abundant N6-methyladenosine (m6A) modification on mRNAs is installed non-stoichiometrically across transcripts, with 5' untranslated regions (5' UTRs) being the least conductive. 5' UTRs are essential for translation initiation, yet the molecular mechanisms orchestrated by m6A remain poorly understood. Here, we combined structural, biochemical, and single-molecule approaches and show that at the most common position, a single m6A does not affect translation yields, the kinetics of translation initiation complex assembly, or start codon recognition both under permissive growth and following exposure to oxidative stress. Cryoelectron microscopy (cryo-EM) structures of the late preinitiation complex reveal that m6A purine ring established stacking interactions with an arginine side chain of the initiation factor eIF2α, although with only a marginal energy contribution, as estimated computationally. These findings provide molecular insights into m6A interactions with the initiation complex and suggest that the subtle stabilization is unlikely to affect the translation dynamics under homeostatic conditions or stress.

    View details for DOI 10.1016/j.molcel.2023.12.028

    View details for PubMedID 38244546

  • tRNA shape is an identity element for an archaeal pyrrolysyl-tRNA synthetase from the human gut. Nucleic acids research Krahn, N., Zhang, J., Melnikov, S. V., Tharp, J. M., Villa, A., Patel, A., Howard, R. J., Gabir, H., Patel, T. R., Stetefeld, J., Puglisi, J., Söll, D. 2023

    Abstract

    Protein translation is orchestrated through tRNA aminoacylation and ribosomal elongation. Among the highly conserved structure of tRNAs, they have distinguishing features which promote interaction with their cognate aminoacyl tRNA synthetase (aaRS). These key features are referred to as identity elements. In our study, we investigated the tRNA:aaRS pair that installs the 22nd amino acid, pyrrolysine (tRNAPyl:PylRS). Pyrrolysyl-tRNA synthetases (PylRSs) are naturally encoded in some archaeal and bacterial genomes to acylate tRNAPyl with pyrrolysine. Their large amino acid binding pocket and poor recognition of the tRNA anticodon have been instrumental in incorporating >200 noncanonical amino acids. PylRS enzymes can be divided into three classes based on their genomic structure. Two classes contain both an N-terminal and C-terminal domain, however the third class (ΔpylSn) lacks the N-terminal domain. In this study we explored the tRNA identity elements for a ΔpylSn tRNAPyl from Candidatus Methanomethylophilus alvus which drives the orthogonality seen with its cognate PylRS (MaPylRS). From aminoacylation and translation assays we identified five key elements in ΔpylSn tRNAPyl necessary for MaPylRS activity. The absence of a base (position 8) and a G-U wobble pair (G28:U42) were found to affect the high-resolution structure of the tRNA, while molecular dynamic simulations led us to acknowledge the rigidity imparted from the G-C base pairs (G3:C70 and G5:C68).

    View details for DOI 10.1093/nar/gkad1188

    View details for PubMedID 38100361

  • Partial spontaneous intersubunit rotations in pretranslocation ribosomes. Proceedings of the National Academy of Sciences of the United States of America Huang, T., Choi, J., Prabhakar, A., Puglisi, J. D., Petrov, A. 2023; 120 (41): e2114979120

    Abstract

    The two main steps of translation, peptidyl transfer, and translocation are accompanied by counterclockwise and clockwise rotations of the large and small ribosomal subunits with respect to each other. Upon peptidyl transfer, the small ribosomal subunit rotates counterclockwise relative to the large subunit, placing the ribosome into the rotated conformation. Simultaneously, tRNAs move into the hybrid conformation, and the L1 stalk moves inward toward the P-site tRNA. The conformational dynamics of pretranslocation ribosomes were extensively studied by ensemble and single-molecule methods. Different experimental modalities tracking ribosomal subunits, tRNAs, and the L1 stalk showed that pretranslocation ribosomes undergo spontaneous conformational transitions. Thus, peptidyl transfer unlocks the ribosome and decreases an energy barrier for the reverse ribosome rotation during translocation. However, the tracking of translation with ribosomes labeled at rRNA helices h44 and H101 showed a lack of spontaneous rotations in pretranslocation complexes. Therefore, reverse intersubunit rotations occur during EF-G catalyzed translocation. To reconcile these views, we used high-speed single-molecule microscopy to follow translation in real time. We showed spontaneous rotations in puromycin-released h44-H101 dye-labeled ribosomes. During elongation, the h44-H101 ribosomes undergo partial spontaneous rotations. Spontaneous rotations in h44-H101-labeled ribosomes are restricted prior to aminoacyl-tRNA binding. The pretranslocation h44-H101 ribosomes spontaneously exchanged between three different rotational states. This demonstrates that peptidyl transfer unlocks spontaneous rotations and pretranslocation ribosomes can adopt several thermally accessible conformations, thus supporting the Brownian model of translocation.

    View details for DOI 10.1073/pnas.2114979120

    View details for PubMedID 37801472

  • Universal features of Nsp1-mediated translational shutdown by coronaviruses. Molecular cell Schubert, K., Karousis, E. D., Ban, I., Lapointe, C. P., Leibundgut, M., Bäumlin, E., Kummerant, E., Scaiola, A., Schönhut, T., Ziegelmüller, J., Puglisi, J. D., Mühlemann, O., Ban, N. 2023; 83 (19): 3546-3557.e8

    Abstract

    Nonstructural protein 1 (Nsp1) produced by coronaviruses inhibits host protein synthesis. The severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) Nsp1 C-terminal domain was shown to bind the ribosomal mRNA channel to inhibit translation, but it is unclear whether this mechanism is broadly used by coronaviruses, whether the Nsp1 N-terminal domain binds the ribosome, or how Nsp1 allows viral RNAs to be translated. Here, we investigated Nsp1 from SARS-CoV-2, Middle East respiratory syndrome coronavirus (MERS-CoV), and Bat-Hp-CoV coronaviruses using structural, biophysical, and biochemical experiments, revealing a conserved role for the C-terminal domain. Additionally, the N-terminal domain of Bat-Hp-CoV Nsp1 binds to the decoding center of the 40S subunit, where it would prevent mRNA and eIF1A accommodation. Structure-based experiments demonstrated the importance of decoding center interactions in all three coronaviruses and showed that the same regions of Nsp1 are necessary for the selective translation of viral RNAs. Our results provide a mechanistic framework to understand how Nsp1 controls preferential translation of viral RNAs.

    View details for DOI 10.1016/j.molcel.2023.09.002

    View details for PubMedID 37802027

  • Human immunodeficiency virus 1 5'-leader mutations in plasma viruses before and after the development of reverse transcriptase inhibitor-resistance mutations. The Journal of general virology Nouhin, J., Tzou, P. L., Rhee, S., Sahoo, M. K., Pinsky, B. A., Krupkin, M., Puglisi, J. D., Puglisi, E. V., Shafer, R. W. 2023; 104 (10)

    Abstract

    Human immunodeficiency virus 1 (HIV-1) reverse transcriptase (RT) initiation depends on interaction between viral 5'-leader RNA, RT and host tRNA3Lys. Therefore, we sought to identify co-evolutionary changes between the 5'-leader and RT in viruses developing RT-inhibitor resistance mutations. We sequenced 5'-leader positions 37-356 of paired plasma virus samples from 29 individuals developing the nucleoside RT inhibitor (NRTI)-resistance mutation M184V, 19 developing a non-nucleoside RT inhibitor (NNRTI)-resistance mutation and 32 untreated controls. 5'-Leader variants were defined as positions where ≥20 % of next-generation sequencing (NGS) reads differed from the HXB2 sequence. Emergent mutations were defined as nucleotides undergoing a ≥4-fold change in proportion between baseline and follow-up. Mixtures were defined as positions containing ≥2 nucleotides each present in ≥20 % of NGS reads. Among 80 baseline sequences, 87 positions (27.2 %) contained a variant; 52 contained a mixture. Position 201 was the only position more likely to develop a mutation in the M184V (9/29 vs 0/32; P=0.0006) or NNRTI-resistance (4/19 vs 0/32; P=0.02; Fisher's exact test) groups than the control group. Mixtures at positions 200 and 201occurred in 45.0 and 28.8 %, respectively, of baseline samples. Because of the high proportion of mixtures at these positions, we analysed 5'-leader mixture frequencies in two additional datasets: five publications reporting 294 dideoxyterminator clonal GenBank sequences from 42 individuals and six National Center for Biotechnology Information (NCBI) BioProjects reporting NGS datasets from 295 individuals. These analyses demonstrated position 200 and 201 mixtures at proportions similar to those in our samples and at frequencies several times higher than at all other 5'-leader positions. Although we did not convincingly document co-evolutionary changes between RT and 5'-leader sequences, we identified a novel phenomenon, wherein positions 200 and 201 immediately downstream of the HIV-1 primer binding site exhibited an extraordinarily high likelihood of containing a nucleotide mixture. Possible explanations for the high mixture rates are that these positions are particularly error-prone or provide a viral fitness advantage.

    View details for DOI 10.1099/jgv.0.001898

    View details for PubMedID 37801004

  • Real-time detection of human telomerase DNA synthesis by multiplexed single-molecule FRET. Biophysical journal Hentschel, J., Badstübner, M., Choi, J., Bagshaw, C. R., Lapointe, C. P., Wang, J., Jansson, L. I., Puglisi, J. D., Stone, M. D. 2023

    Abstract

    Genomic stability in proliferating cells critically depends on telomere maintenance by telomerase reverse transcriptase. Here we report the development and proof-of-concept results of a single-molecule approach to monitor the catalytic activity of human telomerase in real time and with single-nucleotide resolution. Using zero-mode waveguides and multi-color FRET, we recorded the processive addition of multiple telomeric repeats to individual DNA primers. Unlike existing biophysical and biochemical tools, the novel approach enables the quantification of nucleotide-binding kinetics prior to nucleotide incorporation. Moreover, it provides means to dissect the unique translocation dynamics that telomerase must undergo after synthesis of each hexameric DNA repeat. We observed an unexpectedly prolonged binding dwell time of dGTP in the enzyme active site at the start of each repeat synthesis cycle, suggesting that telomerase translocation is composed of multiple rate-contributing sub-steps that evade classical biochemical analysis.

    View details for DOI 10.1016/j.bpj.2023.07.019

    View details for PubMedID 37515327

  • Pressure pushes tRNALys3 into excited conformational states. Proceedings of the National Academy of Sciences of the United States of America Wang, J., Koduru, T., Harish, B., McCallum, S. A., Larsen, K. P., Patel, K. S., Peters, E. V., Gillilan, R. E., Puglisi, E. V., Puglisi, J. D., Makhatadze, G., Royer, C. A. 2023; 120 (26): e2215556120

    Abstract

    Conformational dynamics play essential roles in RNA function. However, detailed structural characterization of excited states of RNA remains challenging. Here, we apply high hydrostatic pressure (HP) to populate excited conformational states of tRNALys3, and structurally characterize them using a combination of HP 2D-NMR, HP-SAXS (HP-small-angle X-ray scattering), and computational modeling. HP-NMR revealed that pressure disrupts the interactions of the imino protons of the uridine and guanosine U-A and G-C base pairs of tRNALys3. HP-SAXS profiles showed a change in shape, but no change in overall extension of the transfer RNA (tRNA) at HP. Configurations extracted from computational ensemble modeling of HP-SAXS profiles were consistent with the NMR results, exhibiting significant disruptions to the acceptor stem, the anticodon stem, and the D-stem regions at HP. We propose that initiation of reverse transcription of HIV RNA could make use of one or more of these excited states.

    View details for DOI 10.1073/pnas.2215556120

    View details for PubMedID 37339210

  • HIV-1 5'-Leader Mutations in Plasma Viruses Before and After the Development of Reverse Transcriptase Inhibitor-Resistance Mutations. medRxiv : the preprint server for health sciences Nouhin, J., Tzou, P., Rhee, S., Sahoo, M. K., Pinsky, B. A., Krupkin, M. A., Puglisi, J. D., Puglisi, E. V., Shafer, R. W. 2023

    Abstract

    Background: HIV-1 RT initiation depends on interaction between viral 5'-leader RNA, RT, and host tRNA3 Lys . We therefore sought to identify co-evolutionary changes between the 5'-leader and RT in viruses developing RT-inhibitor resistance mutations.Methods: We sequenced 5'-leader positions 37-356 of paired plasma virus samples from 29 individuals developing the NRTI-resistance mutation M184V, 19 developing an NNRTI-resistance mutation, and 32 untreated controls. 5'-leader variants were defined as positions where ≥20% of NGS reads differed from the HXB2 sequence. Emergent mutations were defined as nucleotides undergoing ≥4-fold change in proportion between baseline and follow-up. Mixtures were defined as positions containing ≥2 nucleotides each present in ≥20% of NGS reads.Results: Among 80 baseline sequences, 87 positions (27.2%) contained a variant; 52 contained a mixture. Position 201 was the only position more likely to develop a mutation in the M184V (9/29 vs. 0/32; p=0.0006) or NNRTI-resistance (4/19 vs. 0/32; p=0.02; Fisher's Exact Test) groups than the control group. Mixtures at positions 200 and 201 occurred in 45.0% and 28.8%, respectively, of baseline samples. Because of the high proportion of mixtures at these positions, we analyzed 5'-leader mixture frequencies in two additional datasets: five publications reporting 294 dideoxyterminator clonal GenBank sequences from 42 individuals and six NCBI BioProjects reporting NGS datasets from 295 individuals. These analyses demonstrated position 200 and 201 mixtures at proportions similar to those in our samples and at frequencies several times higher than at all other 5'-leader positions.Conclusions: Although we did not convincingly document co-evolutionary changes between RT and 5'-leader sequences, we identified a novel phenomenon, wherein positions 200 and 201, immediately downstream of the HIV-1 primer binding site exhibited an extraordinarily high likelihood of containing a nucleotide mixture. Possible explanations for the high mixture rates are that these positions are particularly error-prone or provide a viral fitness advantage.

    View details for DOI 10.1101/2023.06.04.23290942

    View details for PubMedID 37333388

  • Universal features of Nsp1-mediated translational shutdown by coronaviruses. bioRxiv : the preprint server for biology Schubert, K., Karousis, E. D., Ban, I., Lapointe, C. P., Leibundgut, M., Baumlin, E., Kummerant, E., Scaiola, A., Schonhut, T., Ziegelmuller, J., Puglisi, J. D., Muhlemann, O., Ban, N. 2023

    Abstract

    Nonstructural protein 1 (Nsp1) produced by coronaviruses shuts down host protein synthesis in infected cells. The C-terminal domain of SARS-CoV-2 Nsp1 was shown to bind to the small ribosomal subunit to inhibit translation, but it is not clear whether this mechanism is broadly used by coronaviruses, whether the N-terminal domain of Nsp1 binds the ribosome, or how Nsp1 specifically permits translation of viral mRNAs. Here, we investigated Nsp1 from three representative Betacoronaviruses - SARS-CoV-2, MERS-CoV, and Bat-Hp-CoV - using structural, biophysical, and biochemical assays. We revealed a conserved mechanism of host translational shutdown across the three coronaviruses. We further demonstrated that the N-terminal domain of Bat-Hp-CoV Nsp1 binds to the decoding center of the 40S subunit, where it would prevent mRNA and eIF1A binding. Structure-based biochemical experiments identified a conserved role of these inhibitory interactions in all three coronaviruses and showed that the same regions of Nsp1 are responsible for the preferential translation of viral mRNAs. Our results provide a mechanistic framework to understand how Betacoronaviruses overcome translational inhibition to produce viral proteins.

    View details for DOI 10.1101/2023.05.31.543022

    View details for PubMedID 37398176

  • Dynamics of release factor recycling during translation termination in bacteria. Nucleic acids research Prabhakar, A., Pavlov, M. Y., Zhang, J., Indrisiunaite, G., Wang, J., Lawson, M. R., Ehrenberg, M., Puglisi, J. D. 2023

    Abstract

    In bacteria, release of newly synthesized proteins from ribosomes during translation termination is catalyzed by class-I release factors (RFs) RF1 or RF2, reading UAA and UAG or UAA and UGA codons, respectively. Class-I RFs are recycled from the post-termination ribosome by a class-II RF, the GTPase RF3, which accelerates ribosome intersubunit rotation and class-I RF dissociation. How conformational states of the ribosome are coupled to the binding and dissociation of the RFs remains unclear and the importance of ribosome-catalyzed guanine nucleotide exchange on RF3 for RF3 recycling in vivo has been disputed. Here, we profile these molecular events using a single-molecule fluorescence assay to clarify the timings of RF3 binding and ribosome intersubunit rotation that trigger class-I RF dissociation, GTP hydrolysis, and RF3 dissociation. These findings in conjunction with quantitative modeling of intracellular termination flows reveal rapid ribosome-dependent guanine nucleotide exchange to be crucial for RF3 action in vivo.

    View details for DOI 10.1093/nar/gkad286

    View details for PubMedID 37102635

  • Basis of speed and fidelity in eukaryotic translation termination. Biophysical journal Lawson, M. R., Lessen, L. N., Green, R., Puglisi, J. D. 2023; 122 (3S1): 317a

    View details for DOI 10.1016/j.bpj.2022.11.1779

    View details for PubMedID 36783595

  • Rapid 40S scanning and its regulation by mRNA structure during eukaryotic translation initiation. Cell Wang, J., Shin, B., Alvarado, C., Kim, J., Bohlen, J., Dever, T. E., Puglisi, J. D. 2022

    Abstract

    How the eukaryotic 43S preinitiation complex scans along the 5' untranslated region (5' UTR) of a capped mRNA to locate the correct start codon remains elusive. Here, we directly track yeast 43S-mRNA binding, scanning, and 60S subunit joining by real-time single-molecule fluorescence spectroscopy. 43S engagement with mRNA occurs through a slow, ATP-dependent process driven by multiple initiation factors including the helicase eIF4A. Once engaged, 43S scanning occurs rapidly and directionally at 100 nucleotides per second, independent of multiple cycles of ATP hydrolysis by RNA helicases post ribosomal loading. Scanning ribosomes can proceed through RNA secondary structures, but 5' UTR hairpin sequences near start codons drive scanning ribosomes at start codons backward in the 5' direction, requiring rescanning to arrive once more at a start codon. Direct observation of scanning ribosomes provides a mechanistic framework for translational regulation by 5' UTR structures and upstream near-cognate start codons.

    View details for DOI 10.1016/j.cell.2022.10.005

    View details for PubMedID 36334590

  • Uncovering translation roadblocks during the development of a synthetic tRNA. Nucleic acids research Prabhakar, A., Krahn, N., Zhang, J., Vargas-Rodriguez, O., Krupkin, M., Fu, Z., Acosta-Reyes, F. J., Ge, X., Choi, J., Crnkovic, A., Ehrenberg, M., Puglisi, E. V., Soll, D., Puglisi, J. 2022

    Abstract

    Ribosomes are remarkable in their malleability to accept diverse aminoacyl-tRNA substrates from both the same organism and other organisms or domains of life. This is a critical feature of the ribosome that allows the use of orthogonal translation systems for genetic code expansion. Optimization of these orthogonal translation systems generally involves focusing on the compatibility of the tRNA, aminoacyl-tRNA synthetase, and a non-canonical amino acid with each other. As we expand the diversity of tRNAs used to include non-canonical structures, the question arises as to the tRNA suitability on the ribosome. Specifically, we investigated the ribosomal translation of allo-tRNAUTu1, a uniquely shaped (9/3) tRNA exploited for site-specific selenocysteine insertion, using single-molecule fluorescence. With this technique we identified ribosomal disassembly occurring from translocation of allo-tRNAUTu1 from the A to the P site. Using cryo-EM to capture the tRNA on the ribosome, we pinpointed a distinct tertiary interaction preventing fluid translocation. Through a single nucleotide mutation, we disrupted this tertiary interaction and relieved the translation roadblock. With the continued diversification of genetic code expansion, our work highlights a targeted approach to optimize translation by distinct tRNAs as they move through the ribosome.

    View details for DOI 10.1093/nar/gkac576

    View details for PubMedID 35882385

  • eIF5B and eIF1A reorient initiator tRNA to allow ribosomal subunit joining. Nature Lapointe, C. P., Grosely, R., Sokabe, M., Alvarado, C., Wang, J., Montabana, E., Villa, N., Shin, B., Dever, T. E., Fraser, C. S., Fernandez, I. S., Puglisi, J. D. 2022

    Abstract

    Translation initiation defines the identity and quantity of a synthesized protein. The process is dysregulated in many human diseases1,2. A key commitment step is when the ribosomal subunits join at a translation start site on a messenger RNA to form a functional ribosome. Here, we combined single-molecule spectroscopy and structural methods using an in vitro reconstituted system to examine how the human ribosomal subunits join. Single-molecule fluorescence revealed when theuniversally conserved eukaryotic initiation factors eIF1A and eIF5B associate with and depart from initiation complexes. Guided by single-molecule dynamics, we visualized initiation complexes that contained both eIF1A and eIF5B using single-particle cryo-electron microscopy. The resulting structure revealed how eukaryote-specific contacts between the two proteins remodel the initiation complex to orient the initiator aminoacyl-tRNA in a conformation compatible with ribosomal subunit joining. Collectively, our findings provide a quantitative and architectural framework for the molecular choreography orchestrated by eIF1A and eIF5B during translation initiation in humans.

    View details for DOI 10.1038/s41586-022-04858-z

    View details for PubMedID 35732735

  • Direct tracking of eukaryotic translation termination dynamics Lawson, M. R., Lessen, L., Wang, J., Green, R., Puglisi, J. D. CELL PRESS. 2022: 202A
  • 40S scanning unveiled by smFRET Wang, J., Puglisi, J. D. CELL PRESS. 2022: 33
  • Pressure Effects on the Conformational Transitions of tRNA(Lys3) Wang, J., Harish, B., Larsen, K., Puglisi, J. D., Gillilan, R., Royer, C. A. CELL PRESS. 2021: 315A
  • N 6-Methyladenosines in mRNAs reduce the accuracy of codon reading by transfer RNAs and peptide release factors. Nucleic acids research Ieong, K., Indrisiunaite, G., Prabhakar, A., Puglisi, J. D., Ehrenberg, M. 2021

    Abstract

    We used quench flow to study how N6-methylated adenosines (m6A) affect the accuracy ratio between kcat/Km (i.e. association rate constant (ka) times probability (Pp) of product formation after enzyme-substrate complex formation) for cognate and near-cognate substrate for mRNA reading by tRNAs and peptide release factors 1 and 2 (RFs) during translation with purified Escherichia coli components. We estimated kcat/Km for Glu-tRNAGlu, EF-Tu and GTP forming ternary complex (T3) reading cognate (GAA and Gm6AA) or near-cognate (GAU and Gm6AU) codons. ka decreased 10-fold by m6A introduction in cognate and near-cognate cases alike, while Pp for peptidyl transfer remained unaltered in cognate but increased 10-fold in near-cognate case leading to 10-fold amino acid substitution error increase. We estimated kcat/Km for ester bond hydrolysis of P-site bound peptidyl-tRNA by RF2 reading cognate (UAA and Um6AA) and near-cognate (UAG and Um6AG) stop codons to decrease 6-fold or 3-fold by m6A introduction, respectively.This 6-fold effect on UAA reading was also observed in a single-molecule termination assay. Thus, m6A reduces both sense and stop codon reading accuracy by decreasing cognate significantly more than near-cognate kcat/Km, in contrast to most error inducing agents and mutations, which increase near-cognate at unaltered cognate kcat/Km.

    View details for DOI 10.1093/nar/gkab033

    View details for PubMedID 33561188

  • Dynamic competition between SARS-CoV-2 NSP1 and mRNA on the human ribosome inhibits translation initiation. Proceedings of the National Academy of Sciences of the United States of America Lapointe, C. P., Grosely, R. n., Johnson, A. G., Wang, J. n., Fernández, I. S., Puglisi, J. D. 2021; 118 (6)

    Abstract

    Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is a beta-CoV that recently emerged as a human pathogen and is the causative agent of the COVID-19 pandemic. A molecular framework of how the virus manipulates host cellular machinery to facilitate infection remains unclear. Here, we focus on SARS-CoV-2 NSP1, which is proposed to be a virulence factor that inhibits protein synthesis by directly binding the human ribosome. We demonstrate biochemically that NSP1 inhibits translation of model human and SARS-CoV-2 messenger RNAs (mRNAs). NSP1 specifically binds to the small (40S) ribosomal subunit, which is required for translation inhibition. Using single-molecule fluorescence assays to monitor NSP1-40S subunit binding in real time, we determine that eukaryotic translation initiation factors (eIFs) allosterically modulate the interaction of NSP1 with ribosomal preinitiation complexes in the absence of mRNA. We further elucidate that NSP1 competes with RNA segments downstream of the start codon to bind the 40S subunit and that the protein is unable to associate rapidly with 80S ribosomes assembled on an mRNA. Collectively, our findings support a model where NSP1 proteins from viruses in at least two subgenera of beta-CoVs associate with the open head conformation of the 40S subunit to inhibit an early step of translation, by preventing accommodation of mRNA within the entry channel.

    View details for DOI 10.1073/pnas.2017715118

    View details for PubMedID 33479166

  • Mechanisms that ensure speed and fidelity in eukaryotic translation termination. Science (New York, N.Y.) Lawson, M. R., Lessen, L. N., Wang, J., Prabhakar, A., Corsepius, N. C., Green, R., Puglisi, J. D. 2021; 373 (6557): 876-882

    Abstract

    Translation termination, which liberates a nascent polypeptide from the ribosome specifically at stop codons, must occur accurately and rapidly. We established single-molecule fluorescence assays to track the dynamics of ribosomes and two requisite release factors (eRF1 and eRF3) throughout termination using an in vitro-reconstituted yeast translation system. We found that the two eukaryotic release factors bound together to recognize stop codons rapidly and elicit termination through a tightly regulated, multistep process that resembles transfer RNA selection during translation elongation. Because the release factors are conserved from yeast to humans, the molecular events that underlie yeast translation termination are likely broadly fundamental to eukaryotic protein synthesis.

    View details for DOI 10.1126/science.abi7801

    View details for PubMedID 34413231

  • Structural basis for the transition from translation initiation to elongation by an 80S-eIF5B complex. Nature communications Wang, J., Wang, J., Shin, B., Kim, J., Dever, T. E., Puglisi, J. D., Fernandez, I. S. 2020; 11 (1): 5003

    Abstract

    Recognition of a start codon by the initiator aminoacyl-tRNA determines the reading frame of messenger RNA (mRNA) translation by the ribosome. In eukaryotes, the GTPase eIF5B collaborates in the correct positioning of the initiator Met-tRNAiMet on the ribosome in the later stages of translation initiation, gating entrance into elongation. Leveraging the long residence time of eIF5B on the ribosome recently identified by single-molecule fluorescence measurements, we determine the cryoEM structure of the naturally long-lived ribosome complex with eIF5B and Met-tRNAiMet immediately before transition into elongation. The structure uncovers an unexpected, eukaryotic specific and dynamic fidelity checkpoint implemented by eIF5B in concert with components of the large ribosomal subunit.

    View details for DOI 10.1038/s41467-020-18829-3

    View details for PubMedID 33024099

  • Polysomes Bypass a 50 Nucleotide Coding Gap less Efficiently than Monosomes Due to Attenuation of a 5' mRNA Stem Loop and Enhanced Drop-off. Journal of molecular biology O'Loughlin, S., Capece, M. C., Klimova, M., Wills, N. M., Coakley, A., Samatova, E., O'Connor, P. B., Loughran, G., Weissman, J. S., Baranov, P. V., Rodnina, M. V., Puglisi, J. D., Atkins, J. F. 2020

    Abstract

    Efficient translational bypassing of a 50 nt non-coding gap in a phage T4 topoisomerase subunit gene (gp60) requires several recoding signals. Here we investigate the function of the mRNA stem loop 5' of the take-off codon, as well as the importance of ribosome loading density on the mRNA for efficient bypassing. We show that polysomes are less efficient at mediating bypassing than monosomes, both in vitro and in vivo, due to their preventing formation of a stem loop 5' of the take-off codon and allowing greater peptidyl-tRNA drop off. A ribosome profiling analysis of phage T4 infected E. coli yielded protected mRNA fragments within the normal size range derived from ribosomes stalled at the take-off codon. However, ribosomes at this position also yielded some 53 nucleotide fragments, 16 longer. These were due to protection of the nucleotides that form the 5' stem loop. NMR shows that the 5' stem loop is highly dynamic. The importance of different nucleotides in the 5' stem loop is revealed by mutagenesis studies. These data highlight the significance of the 5' stem loop for the 50 nt bypassing, and further enhance appreciation of relevance of the extent of ribosome loading for recoding.

    View details for DOI 10.1016/j.jmb.2020.05.010

    View details for PubMedID 32454154

  • A memory of eS25 loss drives resistance phenotypes. Nucleic acids research Johnson, A. G., Flynn, R. A., Lapointe, C. P., Ooi, Y. S., Zhao, M. L., Richards, C. M., Qiao, W. n., Yamada, S. B., Couthouis, J. n., Gitler, A. D., Carette, J. E., Puglisi, J. D. 2020

    Abstract

    In order to maintain cellular protein homeostasis, ribosomes are safeguarded against dysregulation by myriad processes. Remarkably, many cell types can withstand genetic lesions of certain ribosomal protein genes, some of which are linked to diverse cellular phenotypes and human disease. Yet the direct and indirect consequences from these lesions are poorly understood. To address this knowledge gap, we studied in vitro and cellular consequences that follow genetic knockout of the ribosomal proteins RPS25 or RACK1 in a human cell line, as both proteins are implicated in direct translational control. Prompted by the unexpected detection of an off-target ribosome alteration in the RPS25 knockout, we closely interrogated cellular phenotypes. We found that multiple RPS25 knockout clones display viral- and toxin-resistance phenotypes that cannot be rescued by functional cDNA expression, suggesting that RPS25 loss elicits a cell state transition. We characterized this state and found that it underlies pleiotropic phenotypes and has a common rewiring of gene expression. Rescuing RPS25 expression by genomic locus repair failed to correct for the phenotypic and expression hysteresis. Our findings illustrate how the elasticity of cells to a ribosome perturbation can drive specific phenotypic outcomes that are indirectly linked to translation and suggests caution in the interpretation of ribosomal protein gene mutation data.

    View details for DOI 10.1093/nar/gkaa444

    View details for PubMedID 32463448

  • The energy landscape of -1 ribosomal frameshifting. Science advances Choi, J. n., O'Loughlin, S. n., Atkins, J. F., Puglisi, J. D. 2020; 6 (1): eaax6969

    Abstract

    Maintenance of translational reading frame ensures the fidelity of information transfer during protein synthesis. Yet, programmed ribosomal frameshifting sequences within the coding region promote a high rate of reading frame change at predetermined sites thus enriching genomic information density. Frameshifting is typically stimulated by the presence of 3' messenger RNA (mRNA) structures, but how these mRNA structures enhance -1 frameshifting remains debatable. Here, we apply single-molecule and ensemble approaches to formulate a mechanistic model of ribosomal -1 frameshifting. Our model suggests that the ribosome is intrinsically susceptible to frameshift before its translocation and this transient state is prolonged by the presence of a precisely positioned downstream mRNA structure. We challenged this model using temperature variation in vivo, which followed the prediction made based on in vitro results. Our results provide a quantitative framework for analyzing other frameshifting enhancers and a potential approach to control gene expression dynamically using programmed frameshifting.

    View details for DOI 10.1126/sciadv.aax6969

    View details for PubMedID 31911945

    View details for PubMedCentralID PMC6938710

  • A short translational ramp determines the efficiency of protein synthesis. Nature communications Verma, M., Choi, J., Cottrell, K. A., Lavagnino, Z., Thomas, E. N., Pavlovic-Djuranovic, S., Szczesny, P., Piston, D. W., Zaher, H. S., Puglisi, J. D., Djuranovic, S. 2019; 10 (1): 5774

    Abstract

    Translation initiation is a major rate-limiting step for protein synthesis. However, recent studies strongly suggest that the efficiency of protein synthesis is additionally regulated by multiple factors that impact the elongation phase. To assess the influence of early elongation on protein synthesis, we employed a library of more than 250,000 reporters combined with in vitro and in vivo protein expression assays. Here we report that the identity of the amino acids encoded by codons 3 to 5 impact protein yield. This effect is independent of tRNA abundance, translation initiation efficiency, or overall mRNA structure. Single-molecule measurements of translation kinetics revealed pausing of the ribosome and aborted protein synthesis on codons 4 and 5 of distinct amino acid and nucleotide compositions. Finally, introduction of preferred sequence motifs only at specific codon positions improves protein synthesis efficiency for recombinant proteins. Collectively, our data underscore the critical role of early elongation events in translational control of gene expression.

    View details for DOI 10.1038/s41467-019-13810-1

    View details for PubMedID 31852903

  • Dynamics of the context-specific translation arrest by chloramphenicol and linezolid. Nature chemical biology Choi, J., Marks, J., Zhang, J., Chen, D., Wang, J., Vazquez-Laslop, N., Mankin, A. S., Puglisi, J. D. 2019

    Abstract

    Chloramphenicol (CHL) and linezolid (LZD) are antibiotics that inhibit translation. Both were thought to block peptide-bond formation between all combinations of amino acids. Yet recently, a strong nascent peptide context-dependency of CHL- and LZD-induced translation arrest was discovered. Here we probed the mechanism of action of CHL and LZD by using single-molecule Forster resonance energy transfer spectroscopy to monitor translation arrest induced by antibiotics. The presence of CHL or LZD does not substantially alter dynamics of protein synthesis until the arrest-motif of the nascent peptide is generated. Inhibition of peptide-bond formation compels the fully accommodated A-site transfer RNA to undergo repeated rounds of dissociation and nonproductive rebinding. The glycyl amino-acid moiety on the A-site Gly-tRNA manages to overcome the arrest by CHL. Our results illuminate the mechanism of CHL and LZD action through their interactions with the ribosome, the nascent peptide and the incoming amino acid, perturbing elongation dynamics.

    View details for DOI 10.1038/s41589-019-0423-2

    View details for PubMedID 31844301

  • Mechanism of ribosome stalling during translation of a poly(A) tail. Nature structural & molecular biology Chandrasekaran, V., Juszkiewicz, S., Choi, J., Puglisi, J. D., Brown, A., Shao, S., Ramakrishnan, V., Hegde, R. S. 2019

    Abstract

    Faulty or damaged messenger RNAs are detected by the cell when translating ribosomes stall during elongation and trigger pathways of mRNA decay, nascent protein degradation and ribosome recycling. The most common mRNA defect in eukaryotes is probably inappropriate polyadenylation at near-cognate sites within the coding region. How ribosomes stall selectively when they encounter poly(A) is unclear. Here, we use biochemical and structural approaches in mammalian systems to show that poly-lysine, encoded by poly(A), favors a peptidyl-transfer RNA conformation suboptimal for peptide bond formation. This conformation partially slows elongation, permitting poly(A) mRNA in the ribosome's decoding center to adopt a ribosomal RNA-stabilized single-stranded helix. The reconfigured decoding center clashes with incoming aminoacyl-tRNA, thereby precluding elongation. Thus, coincidence detection of poly-lysine in the exit tunnel and poly(A) in the decoding center allows ribosomes to detect aberrant mRNAs selectively, stall elongation and trigger downstream quality control pathways essential for cellular homeostasis.

    View details for DOI 10.1038/s41594-019-0331-x

    View details for PubMedID 31768042

  • Transient Protein-RNA Interactions Guide Nascent Ribosomal RNA Folding. Cell Duss, O., Stepanyuk, G. A., Puglisi, J. D., Williamson, J. R. 2019

    Abstract

    Ribosome assembly is an efficient but complex and heterogeneous process during which ribosomal proteins assemble on the nascent rRNA during transcription. Understanding how the interplay between nascent RNA folding and protein binding determines the fate of transcripts remains a major challenge. Here, using single-molecule fluorescence microscopy, we follow assembly of the entire 3' domain of the bacterial small ribosomal subunit in real time. We find that co-transcriptional rRNA folding is complicated by the formation of long-range RNA interactions and that r-proteins self-chaperone the rRNA folding process prior to stable incorporation into a ribonucleoprotein (RNP) complex. Assembly is initiated by transient rather than stable protein binding, and the protein-RNA binding dynamics gradually decrease during assembly. This work questions the paradigm of strictly sequential and cooperative ribosome assembly and suggests that transient binding of RNA binding proteins to cellular RNAs could provide a general mechanism to shape nascent RNA folding during RNP assembly.

    View details for DOI 10.1016/j.cell.2019.10.035

    View details for PubMedID 31761533

  • Relating Structure and Dynamics in RNA Biology. Cold Spring Harbor perspectives in biology Larsen, K. P., Choi, J., Prabhakar, A., Puglisi, E. V., Puglisi, J. D. 2019; 11 (7)

    Abstract

    SUMMARYRecent advances in structural biology methods have enabled a surge in the number of RNA and RNA-protein assembly structures available at atomic or near-atomic resolution. These complexes are often trapped in discrete conformational states that exist along a mechanistic pathway. Single-molecule fluorescence methods provide temporal resolution to elucidate the dynamic mechanisms of processes involving complex RNA and RNA-protein assemblies, but interpretation of such data often requires previous structural knowledge. Here we highlight how single-molecule tools can directly complement structural approaches for two processes--translation and reverse transcription-to provide a dynamic view of molecular function.

    View details for DOI 10.1101/cshperspect.a032474

    View details for PubMedID 31262948

  • RACK1 on and off the ribosome RNA Johnson, A. G., Lapointe, C. P., Wang, J., Corsepius, N. C., Choi, J., Fuchs, G., Puglisi, J. D. 2019; 25 (7): 881–95
  • Expanding single-molecule fluorescence spectroscopy to capture complexity in biology. Current opinion in structural biology Choi, J., Grosely, R., Puglisi, E. V., Puglisi, J. D. 2019

    Abstract

    Fundamental biological processes are driven by diverse molecular machineries. In recent years, single-molecule fluorescence spectroscopy has matured as a unique tool in biology to study how structural dynamics of molecular complexes drive various biochemical reactions. In this review, we highlight underlying developments in single-molecule fluorescence methods that enable deep biological investigations. Recent progress in these methods points toward increasing complexity of measurements to capture biological processes in a living cell, where multiple processes often occur simultaneously and are mechanistically coupled.

    View details for DOI 10.1016/j.sbi.2019.05.005

    View details for PubMedID 31213390

  • RPS25 is required for efficient RAN translation of C9orf72 and other neurodegenerative disease-associated nucleotide repeats. Nature neuroscience Yamada, S. B., Gendron, T. F., Niccoli, T. n., Genuth, N. R., Grosely, R. n., Shi, Y. n., Glaria, I. n., Kramer, N. J., Nakayama, L. n., Fang, S. n., Dinger, T. J., Thoeng, A. n., Rocha, G. n., Barna, M. n., Puglisi, J. D., Partridge, L. n., Ichida, J. K., Isaacs, A. M., Petrucelli, L. n., Gitler, A. D. 2019

    Abstract

    Nucleotide repeat expansions in the C9orf72 gene are the most common cause of amyotrophic lateral sclerosis and frontotemporal dementia. Unconventional translation (RAN translation) of C9orf72 repeats generates dipeptide repeat proteins that can cause neurodegeneration. We performed a genetic screen for regulators of RAN translation and identified small ribosomal protein subunit 25 (RPS25), presenting a potential therapeutic target for C9orf72-related amyotrophic lateral sclerosis and frontotemporal dementia and other neurodegenerative diseases caused by nucleotide repeat expansions.

    View details for DOI 10.1038/s41593-019-0455-7

    View details for PubMedID 31358992

  • RACK1 on and off the ribosome. RNA (New York, N.Y.) Johnson, A. G., Lapointe, C. P., Wang, J. n., Corsepius, N. C., Choi, J. n., Fuchs, G. n., Puglisi, J. D. 2019

    Abstract

    Receptor for activated C kinase 1 (RACK1) is a eukaryote-specific ribosomal protein implicated in diverse biological functions. To engineer ribosomes for specific fluorescent labeling, we selected RACK1 as a target given its location on the small ribosomal subunit and other properties. However, prior results suggested that RACK1 has roles both on and off the ribosome, and such an exchange might be related to its various cellular functions and hinder our ability to use RACK1 as a stable fluorescent tag for the ribosome. In addition, the kinetics of spontaneous exchange of RACK1 or any ribosomal protein from a mature ribosome in vitro remain unclear. To address these issues, we engineered fluorescently-labeled human ribosomes via RACK1, and applied bulk and single-molecule biochemical analyses to track RACK1 on and off the human ribosome. Our results demonstrate that, despite its cellular non-essentiality from yeast to humans, RACK1 readily re-associates with the ribosome, displays limited conformational dynamics, and remains stably bound to the ribosome for hours in vitro. This work sheds insight into the biochemical basis of ribosomal protein exchange on and off a mature ribosome and provides tools for single-molecule analysis of human translation.

    View details for PubMedID 31023766

  • eIF5B gates the transition from translation initiation to elongation. Nature Wang, J. n., Johnson, A. G., Lapointe, C. P., Choi, J. n., Prabhakar, A. n., Chen, D. H., Petrov, A. N., Puglisi, J. D. 2019

    Abstract

    Translation initiation determines both the quantity and identity of the protein that is encoded in an mRNA by establishing the reading frame for protein synthesis. In eukaryotic cells, numerous translation initiation factors prepare ribosomes for polypeptide synthesis; however, the underlying dynamics of this process remain unclear1,2. A central question is how eukaryotic ribosomes transition from translation initiation to elongation. Here we use in vitro single-molecule fluorescence microscopy approaches in a purified yeast Saccharomyces cerevisiae translation system to monitor directly, in real time, the pathways of late translation initiation and the transition to elongation. This transition was slower in our eukaryotic system than that reported for Escherichia coli3-5. The slow entry to elongation was defined by a long residence time of eukaryotic initiation factor 5B (eIF5B) on the 80S ribosome after the joining of individual ribosomal subunits-a process that is catalysed by this universally conserved initiation factor. Inhibition of the GTPase activity of eIF5B after the joining of ribosomal subunits prevented the dissociation of eIF5B from the 80S complex, thereby preventing elongation. Our findings illustrate how the dissociation of eIF5B serves as a kinetic checkpoint for the transition from initiation to elongation, and how its release may be governed by a change in the conformation of the ribosome complex that triggers GTP hydrolysis.

    View details for DOI 10.1038/s41586-019-1561-0

    View details for PubMedID 31534220

  • Single-Molecule Fluorescence Applied to Translation COLD SPRING HARBOR PERSPECTIVES IN BIOLOGY Prabhakar, A., Puglisi, E., Puglisi, J. D. 2019; 11 (1)
  • Dynamic Interplay of RNA and Protein in the Human Immunodeficiency Virus-1 Reverse Transcription Initiation Complex JOURNAL OF MOLECULAR BIOLOGY Coey, A. T., Larsen, K. P., Choi, J., Barrero, D. J., Puglisi, J. D., Puglisi, E. 2018; 430 (24): 5137–50
  • Real-time assembly of ribonucleoprotein complexes on nascent RNA transcripts. Nature communications Duss, O., Stepanyuk, G. A., Grot, A., O'Leary, S. E., Puglisi, J. D., Williamson, J. R. 2018; 9 (1): 5087

    Abstract

    Cellular protein-RNA complexes assemble on nascent transcripts, but methods to observe transcription and protein binding in real time and at physiological concentrations are not available. Here, we report a single-molecule approach based onzero-mode waveguides that simultaneously tracks transcription progress and the binding of ribosomal protein S15 to nascent RNA transcripts during early ribosome biogenesis. We observe stable binding of S15 to single RNAs immediately after transcription for the majority of the transcripts at 35°C but for less than half at 20°C. The remaining transcripts exhibit either rapid and transient binding or are unable to bind S15, likely due to RNA misfolding. Our work establishes the foundation for studying transcription and its coupled co-transcriptional processes, including RNA folding, ligand binding, and enzymatic activity such as in coupling of transcription to splicing, ribosome assembly or translation.

    View details for PubMedID 30504830

  • De novo computational RNA modeling into cryo-EM maps of large ribonucleoprotein complexes NATURE METHODS Kappel, K., Liu, S., Larsen, K. P., Skiniotis, G., Puglisi, E., Puglisi, J. D., Zhou, Z., Zhao, R., Das, R. 2018; 15 (11): 947-+
  • Dynamic Interplay of RNA and Protein in the Human Immunodeficiency Virus-1 Reverse Transcription Initiation Complex. Journal of molecular biology Coey, A. T., Larsen, K. P., Choi, J., Barrero, D. J., Puglisi, J. D., Puglisi, E. V. 2018

    Abstract

    The initiation of reverse transcription in human immunodeficiency virus-1 (HIV-1) is a key early step in the virus replication cycle. During this process, the viral enzyme reverse transcriptase (RT) copies the single-stranded viral RNA (vRNA) genome into double-stranded DNA using human tRNALys3 as a primer for initiation. The tRNA primer and vRNA genome contain several complementary sequences that are important for regulating reverse transcription initiation kinetics. Using single-molecule Forster resonance energy transfer (smFRET) spectroscopy, we demonstrate that the vRNA-tRNA initiation complex is conformationally heterogeneous and dynamic in the absence of RT. As shown previously, nucleic acid-RT interaction is characterized by rapid dissociation constants. We show that extension of the vRNA-tRNA primer binding site (PBS) helix from 18 base pairs to 22 base pairs stabilizes RT binding to the complex and that the tRNA 5' end has a role in modulating RT binding. RT occupancy on the complex stabilizes helix 1 (H1) formation and reduces global structural heterogeneity. The stabilization of H1 upon RT binding may serve to destabilize helix 2 (H2), the first pause site for RT during initiation, during later steps of reverse transcription initiation.

    View details for PubMedID 30201267

  • Single-Molecule Fluorescence Applied to Translation. Cold Spring Harbor perspectives in biology Prabhakar, A., Puglisi, E. V., Puglisi, J. D. 2018

    Abstract

    Single-molecule fluorescence methods have illuminated the dynamics of the translational machinery. Structural and bulk biochemical experiments have provided detailed atomic and global mechanistic views of translation, respectively. Single-molecule studies of translation have bridged these views by temporally connecting the conformational and compositional states defined from structural data within the mechanistic framework of translation produced from biochemical studies. Here, we discuss the context for applying different single-molecule fluorescence experiments, and present recent applications to studying prokaryotic and eukaryotic translation. We underscore the power of observing single translating ribosomes to delineate and sort complex mechanistic pathways during initiation and elongation, and discuss future applications of current and improved technologies.

    View details for PubMedID 29891562

  • Structural Characterization of the HIV-1 Reverse Transcriptase Initiation Complex Larsen, K., Mathiharan, Y., Kappei, K., Coey, A., Chen, D., Madigan, L., Skiniotis, G., Puglisi, J., Puglisi, E. CELL PRESS. 2018: 193A
  • How 2 '-O-Methylation in mRNA Disrupts tRNA Decoding during Translation Elongation Choi, J., Indrisiunaite, G., DeMirci, H., Ieong, K., Wang, J., Petrov, A., Prabhakar, A., Rechavi, G., Dominissini, D., He, C., Ehrenberg, M., Puglisi, J. D. CELL PRESS. 2018: 592A
  • Architecture of an HIV-1 reverse transcriptase initiation complex. Nature Larsen, K. P., Mathiharan, Y. K., Kappel, K. n., Coey, A. T., Chen, D. H., Barrero, D. n., Madigan, L. n., Puglisi, J. D., Skiniotis, G. n., Puglisi, E. V. 2018

    Abstract

    Reverse transcription of the HIV-1 RNA genome into double-stranded DNA is a central step in viral infection 1 and a common target of antiretroviral drugs 2 . The reaction is catalysed by viral reverse transcriptase (RT)3,4 that is packaged in an infectious virion with two copies of viral genomic RNA 5 each bound to host lysine 3 transfer RNA (tRNALys3), which acts as a primer for initiation of reverse transcription6,7. Upon viral entry into cells, initiation is slow and non-processive compared to elongation8,9. Despite extensive efforts, the structural basis of RT function during initiation has remained a mystery. Here we use cryo-electron microscopy to determine a three-dimensional structure of an HIV-1 RT initiation complex. In our structure, RT is in an inactive polymerase conformation with open fingers and thumb and with the nucleic acid primer-template complex shifted away from the active site. The primer binding site (PBS) helix formed between tRNALys3 and HIV-1 RNA lies in the cleft of RT and is extended by additional pairing interactions. The 5' end of the tRNA refolds and stacks on the PBS to create a long helical structure, while the remaining viral RNA forms two helical stems positioned above the RT active site, with a linker that connects these helices to the RNase H region of the PBS. Our results illustrate how RNA structure in the initiation complex alters RT conformation to decrease activity, highlighting a potential target for drug action.

    View details for PubMedID 29695867

  • 2'-O-methylation in mRNA disrupts tRNA decoding during translation elongation. Nature structural & molecular biology Choi, J. n., Indrisiunaite, G. n., DeMirci, H. n., Ieong, K. W., Wang, J. n., Petrov, A. n., Prabhakar, A. n., Rechavi, G. n., Dominissini, D. n., He, C. n., Ehrenberg, M. n., Puglisi, J. D. 2018

    Abstract

    Chemical modifications of mRNA may regulate many aspects of mRNA processing and protein synthesis. Recently, 2'-O-methylation of nucleotides was identified as a frequent modification in translated regions of human mRNA, showing enrichment in codons for certain amino acids. Here, using single-molecule, bulk kinetics and structural methods, we show that 2'-O-methylation within coding regions of mRNA disrupts key steps in codon reading during cognate tRNA selection. Our results suggest that 2'-O-methylation sterically perturbs interactions of ribosomal-monitoring bases (G530, A1492 and A1493) with cognate codon-anticodon helices, thereby inhibiting downstream GTP hydrolysis by elongation factor Tu (EF-Tu) and A-site tRNA accommodation, leading to excessive rejection of cognate aminoacylated tRNAs in initial selection and proofreading. Our current and prior findings highlight how chemical modifications of mRNA tune the dynamics of protein synthesis at different steps of translation elongation.

    View details for PubMedID 29459784

  • How Messenger RNA and Nascent Chain Sequences Regulate Translation Elongation ANNUAL REVIEW OF BIOCHEMISTRY, VOL 87 Choi, J., Grosely, R., Prabhakar, A., Lapointe, C. P., Wang, J., Puglisi, J. D. edited by Kornberg, R. D. 2018; 87: 421–49
  • Dynamic basis of fidelity and speed in translation: Coordinated multistep mechanisms of elongation and termination. Protein science Prabhakar, A., Choi, J., Wang, J., Petrov, A., Puglisi, J. D. 2017

    Abstract

    As the universal machine that transfers genetic information from RNA to protein, the ribosome synthesizes proteins with remarkably high fidelity and speed. This is a result of the accurate and efficient decoding of mRNA codons via multistep mechanisms during elongation and termination stages of translation. These mechanisms control how the correct sense codon is recognized by a tRNA for peptide elongation, how the next codon is presented to the decoding center without change of frame during translocation, and how the stop codon is discriminated for timely release of the nascent peptide. These processes occur efficiently through coupling of chemical energy expenditure, ligand interactions, and conformational changes. Understanding this coupling in detail required integration of many techniques that were developed in the past two decades. This multidisciplinary approach has revealed the dynamic nature of translational control and uncovered how external cellular factors such as tRNA abundance and mRNA modifications affect the synthesis of the protein product. Insights from these studies will aid synthetic biology and therapeutic approaches to translation.

    View details for DOI 10.1002/pro.3190

    View details for PubMedID 28480640

  • Dynamics of IRES-mediated translation PHILOSOPHICAL TRANSACTIONS OF THE ROYAL SOCIETY B-BIOLOGICAL SCIENCES Johnson, A. G., Grosely, R., Petrov, A. N., Puglisi, J. D. 2017; 372 (1716)

    Abstract

    Viral internal ribosome entry sites (IRESs) are unique RNA elements, which use stable and dynamic RNA structures to recruit ribosomes and drive protein synthesis. IRESs overcome the high complexity of the canonical eukaryotic translation initiation pathway, often functioning with a limited set of eukaryotic initiation factors. The simplest types of IRESs are typified by the cricket paralysis virus intergenic region (CrPV IGR) and hepatitis C virus (HCV) IRESs, both of which independently form high-affinity complexes with the small (40S) ribosomal subunit and bypass the molecular processes of cap-binding and scanning. Owing to their simplicity and ribosomal affinity, the CrPV and HCV IRES have been important models for structural and functional studies of the eukaryotic ribosome during initiation, serving as excellent targets for recent technological breakthroughs in cryogenic electron microscopy (cryo-EM) and single-molecule analysis. High-resolution structural models of ribosome : IRES complexes, coupled with dynamics studies, have clarified decades of biochemical research and provided an outline of the conformational and compositional trajectory of the ribosome during initiation. Here we review recent progress in the study of HCV- and CrPV-type IRESs, highlighting important structural and dynamics insights and the synergy between cryo-EM and single-molecule studies.This article is part of the themed issue 'Perspectives on the ribosome'.

    View details for DOI 10.1098/rstb.2016.0177

    View details for PubMedID 28138065

  • Co-Transcriptional Ribosome Assembly in Real-Time Duss, O., O'Leary, S., Puglisi, J., Williamson, J. CELL PRESS. 2017: 178A
  • Three tRNAs on the ribosome slow translation elongation. Proceedings of the National Academy of Sciences of the United States of America Choi, J. n., Puglisi, J. D. 2017; 114 (52): 13691–96

    Abstract

    During protein synthesis, the ribosome simultaneously binds up to three different transfer RNA (tRNA) molecules. Among the three tRNA binding sites, the regulatory role of the exit (E) site, where deacylated tRNA spontaneously dissociates from the translational complex, has remained elusive. Here we use two donor-quencher pairs to observe and correlate both the conformation of ribosomes and tRNAs as well as tRNA occupancy. Our results reveal a partially rotated state of the ribosome wherein all three tRNA sites are occupied during translation elongation. The appearance and lifetime of this state depend on the E-site tRNA dissociation kinetics, which may vary among tRNA species and depends on temperature and ionic strength. The 3-tRNA partially rotated state is not a proper substrate for elongation factor G (EF-G), thus inhibiting translocation until the E-site tRNA dissociates. Our result presents two parallel kinetic pathways during translation elongation, underscoring the ability of E-site codons to modulate the dynamics of protein synthesis.

    View details for PubMedID 29229848

  • Fluorescently-tagged human eIF3 for single-molecule spectroscopy. Nucleic acids research Johnson, A. G., Petrov, A. N., Fuchs, G. n., Majzoub, K. n., Grosely, R. n., Choi, J. n., Puglisi, J. D. 2017

    Abstract

    Human translation initiation relies on the combined activities of numerous ribosome-associated eukaryotic initiation factors (eIFs). The largest factor, eIF3, is an ∼800 kDa multiprotein complex that orchestrates a network of interactions with the small 40S ribosomal subunit, other eIFs, and mRNA, while participating in nearly every step of initiation. How these interactions take place during the time course of translation initiation remains unclear. Here, we describe a method for the expression and affinity purification of a fluorescently-tagged eIF3 from human cells. The tagged eIF3 dodecamer is structurally intact, functions in cell-based assays, and interacts with the HCV IRES mRNA and the 40S-IRES complex in vitro. By tracking the binding of single eIF3 molecules to the HCV IRES RNA with a zero-mode waveguides-based instrument, we show that eIF3 samples both wild-type IRES and an IRES that lacks the eIF3-binding region, and that the high-affinity eIF3-IRES interaction is largely determined by slow dissociation kinetics. The application of single-molecule methods to more complex systems involving eIF3 may unveil dynamics underlying mRNA selection and ribosome loading during human translation initiation.

    View details for PubMedID 29136179

  • Post-termination Ribosome Intermediate Acts as the Gateway to Ribosome Recycling. Cell reports Prabhakar, A. n., Capece, M. C., Petrov, A. n., Choi, J. n., Puglisi, J. D. 2017; 20 (1): 161–72

    Abstract

    During termination of translation, the nascent peptide is first released from the ribosome, which must be subsequently disassembled into subunits in a process known as ribosome recycling. In bacteria, termination and recycling are mediated by the translation factors RF, RRF, EF-G, and IF3, but their precise roles have remained unclear. Here, we use single-molecule fluorescence to track the conformation and composition of the ribosome in real time during termination and recycling. Our results show that peptide release by RF induces a rotated ribosomal conformation. RRF binds to this rotated intermediate to form the substrate for EF-G that, in turn, catalyzes GTP-dependent subunit disassembly. After the 50S subunit departs, IF3 releases the deacylated tRNA from the 30S subunit, thus preventing reassembly of the 70S ribosome. Our findings reveal the post-termination rotated state as the crucial intermediate in the transition from termination to recycling.

    View details for PubMedID 28683310

  • Heterogeneous structures formed by conserved RNA sequences within the HIV reverse transcription initiation site RNA Coey, A., Larsen, K., Puglisi, J. D., Puglisi, E. V. 2016; 22 (11): 1689-1698

    Abstract

    Reverse transcription is a key process in the early steps of HIV infection. This process initiates within a specific complex formed by the 5' UTR of the HIV genomic RNA (vRNA) and a host primer tRNA(Lys)3 Using nuclear magnetic resonance (NMR) spectroscopy and single-molecule fluorescence spectroscopy, we detect two distinct conformers adopted by the tRNA/vRNA initiation complex. We directly show that an interaction between the conserved 8-nucleotide viral RNA primer activation signal (PAS) and the primer tRNA occurs in one of these conformers. This intermolecular PAS interaction likely induces strain on a vRNA intramolecular helix, which must be broken for reverse transcription to initiate. We propose a mechanism by which this vRNA/tRNA conformer relieves the kinetic block formed by the vRNA intramolecular helix to initiate reverse transcription.

    View details for DOI 10.1261/rna.056804.116

    View details for PubMedID 27613581

  • Amino acid sequence repertoire of the bacterial proteome and the occurrence of untranslatable sequences PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA Navon, S. P., Kornberg, G., Chen, J., Schwartzman, T., Tsai, A., Puglisi, E. V., Puglisi, J. D., Adir, N. 2016; 113 (26): 7166-7170

    Abstract

    Bioinformatic analysis of Escherichia coli proteomes revealed that all possible amino acid triplet sequences occur at their expected frequencies, with four exceptions. Two of the four underrepresented sequences (URSs) were shown to interfere with translation in vivo and in vitro. Enlarging the URS by a single amino acid resulted in increased translational inhibition. Single-molecule methods revealed stalling of translation at the entrance of the peptide exit tunnel of the ribosome, adjacent to ribosomal nucleotides A2062 and U2585. Interaction with these same ribosomal residues is involved in regulation of translation by longer, naturally occurring protein sequences. The E. coli exit tunnel has evidently evolved to minimize interaction with the exit tunnel and maximize the sequence diversity of the proteome, although allowing some interactions for regulatory purposes. Bioinformatic analysis of the human proteome revealed no underrepresented triplet sequences, possibly reflecting an absence of regulation by interaction with the exit tunnel.

    View details for DOI 10.1073/pnas.1606518113

    View details for PubMedID 27307442

  • The molecular choreography of protein synthesis: translational control, regulation, and pathways QUARTERLY REVIEWS OF BIOPHYSICS Chen, J., Choi, J., O'Leary, S. E., Prabhakar, A., Petrov, A., Grosely, R., Puglisi, E. V., Puglisi, J. D. 2016; 49
  • Multiple Parallel Pathways of Translation Initiation on the CrPV IRES. Molecular cell Petrov, A., Grosely, R., Chen, J., O'Leary, S. E., Puglisi, J. D. 2016; 62 (1): 92-103

    Abstract

    The complexity of eukaryotic translation allows fine-tuned regulation of protein synthesis. Viruses use internal ribosome entry sites (IRESs) to minimize or, like the CrPV IRES, eliminate the need for initiation factors. Here, by exploiting the CrPV IRES, we observed the entire process of initiation and transition to elongation in real time. We directly tracked the CrPV IRES, 40S and 60S ribosomal subunits, and tRNA using single-molecule fluorescence spectroscopy and identified multiple parallel initiation pathways within the system. Our results distinguished two pathways of 80S:CrPV IRES complex assembly that produce elongation-competent complexes. Following 80S assembly, the requisite eEF2-mediated translocation results in an unstable intermediate that is captured by binding of the elongator tRNA. Whereas initiation can occur in the 0 and +1 frames, the arrival of the first tRNA defines the reading frame and strongly favors 0 frame initiation. Overall, even in the simplest system, an intricate reaction network regulates translation initiation.

    View details for DOI 10.1016/j.molcel.2016.03.020

    View details for PubMedID 27058789

  • The Dynamic Pathways of Prokaryotic Translation Termination and Recycling Prabhakar, A., Chen, J., Puglisi, J. D. CELL PRESS. 2016: 351A–352A
  • N(6)-methyladenosine in mRNA disrupts tRNA selection and translation-elongation dynamics. Nature structural & molecular biology Choi, J., Ieong, K., Demirci, H., Chen, J., Petrov, A., Prabhakar, A., O'Leary, S. E., Dominissini, D., Rechavi, G., Soltis, S. M., Ehrenberg, M., Puglisi, J. D. 2016; 23 (2): 110-115

    Abstract

    N(6)-methylation of adenosine (forming m(6)A) is the most abundant post-transcriptional modification within the coding region of mRNA, but its role during translation remains unknown. Here, we used bulk kinetic and single-molecule methods to probe the effect of m(6)A in mRNA decoding. Although m(6)A base-pairs with uridine during decoding, as shown by X-ray crystallographic analyses of Thermus thermophilus ribosomal complexes, our measurements in an Escherichia coli translation system revealed that m(6)A modification of mRNA acts as a barrier to tRNA accommodation and translation elongation. The interaction between an m(6)A-modified codon and cognate tRNA echoes the interaction between a near-cognate codon and tRNA, because delay in tRNA accommodation depends on the position and context of m(6)A within codons and on the accuracy level of translation. Overall, our results demonstrate that chemical modification of mRNA can change translational dynamics.

    View details for DOI 10.1038/nsmb.3148

    View details for PubMedID 26751643

  • The noncoding RNAs SNORD50A and SNORD50B bind K-Ras and are recurrently deleted in human cancer. Nature genetics Siprashvili, Z., Webster, D. E., Johnston, D., Shenoy, R. M., Ungewickell, A. J., Bhaduri, A., Flockhart, R., Zarnegar, B. J., Che, Y., Meschi, F., Puglisi, J. D., Khavari, P. A. 2016; 48 (1): 53-58

    Abstract

    Small nucleolar RNAs (snoRNAs) are conserved noncoding RNAs best studied as ribonucleoprotein (RNP) guides in RNA modification. To explore their role in cancer, we compared 5,473 tumor-normal genome pairs to identify snoRNAs with frequent copy number loss. The SNORD50A-SNORD50B snoRNA locus was deleted in 10-40% of 12 common cancers, where its loss was associated with reduced survival. A human protein microarray screen identified direct SNORD50A and SNORD50B RNA binding to K-Ras. Loss of SNORD50A and SNORD50B increased the amount of GTP-bound, active K-Ras and hyperactivated Ras-ERK1/ERK2 signaling. Loss of these snoRNAs also increased binding by farnesyltransferase to K-Ras and increased K-Ras prenylation, suggesting that KRAS mutation might synergize with SNORD50A and SNORD50B loss in cancer. In agreement with this hypothesis, CRISPR-mediated deletion of SNORD50A and SNORD50B in KRAS-mutant tumor cells enhanced tumorigenesis, and SNORD50A and SNORD50B deletion and oncogenic KRAS mutation co-occurred significantly in multiple human tumor types. SNORD50A and SNORD50B snoRNAs thus directly bind and inhibit K-Ras and are recurrently deleted in human cancer.

    View details for DOI 10.1038/ng.3452

    View details for PubMedID 26595770

  • Concentric-flow electrokinetic injector enables serial crystallography of ribosome and photosystem II NATURE METHODS Sierra, R. G., Gati, C., Laksmono, H., Dao, E. H., Gul, S., Fuller, F., Kern, J., Chatterjee, R., Ibrahim, M., Brewster, A. S., Young, I. D., Michels-Clark, T., Aquila, A., Liang, M., Hunter, M. S., Koglin, J. E., Boutet, S., Junco, E. A., Hayes, B., Bogan, M. J., Hampton, C. Y., Puglisi, E. V., Sauter, N. K., Stan, C. A., Zouni, A., Yano, J., Yachandra, V. K., Soltis, S. M., Puglisi, J. D., DeMirci, H. 2016; 13 (1): 59-?

    Abstract

    We describe a concentric-flow electrokinetic injector for efficiently delivering microcrystals for serial femtosecond X-ray crystallography analysis that enables studies of challenging biological systems in their unadulterated mother liquor. We used the injector to analyze microcrystals of Geobacillus stearothermophilus thermolysin (2.2-Å structure), Thermosynechococcus elongatus photosystem II (<3-Å diffraction) and Thermus thermophilus small ribosomal subunit bound to the antibiotic paromomycin at ambient temperature (3.4-Å structure).

    View details for DOI 10.1038/NMETH.3667

    View details for Web of Science ID 000367463600028

    View details for PubMedCentralID PMC4890631

  • Probing the Translation Dynamics of Ribosomes Using Zero-Mode Waveguides. Progress in molecular biology and translational science Tsai, A., Puglisi, J. D., Uemura, S. 2016; 139: 1-43

    Abstract

    In order to coordinate the complex biochemical and structural feat of converting triple-nucleotide codons into their corresponding amino acids, the ribosome must physically manipulate numerous macromolecules including the mRNA, tRNAs, and numerous translation factors. The ribosome choreographs binding, dissociation, physical movements, and structural rearrangements so that they synergistically harness the energy from biochemical processes, including numerous GTP hydrolysis steps and peptide bond formation. Due to the dynamic and complex nature of translation, the large cast of ligands involved, and the large number of possible configurations, tracking the global time evolution or dynamics of the ribosome complex in translation has proven to be challenging for bulk methods. Conventional single-molecule fluorescence experiments on the other hand require low concentrations of fluorescent ligands to reduce background noise. The significantly reduced bimolecular association rates under those conditions limit the number of steps that can be observed within the time window available to a fluorophore. The advent of zero-mode waveguide (ZMW) technology has allowed the study of translation at near-physiological concentrations of labeled ligands, moving single-molecule fluorescence microscopy beyond focused model systems into studying the global dynamics of translation in realistic setups. This chapter reviews the recent works using the ZMW technology to dissect the mechanism of translation initiation and elongation in prokaryotes, including complex processes such as translational stalling and frameshifting. Given the success of the technology, similarly complex biological processes could be studied in near-physiological conditions with the controllability of conventional in vitro experiments.

    View details for DOI 10.1016/bs.pmbts.2015.10.006

    View details for PubMedID 26970189

  • The molecular choreography of protein synthesis: translational control, regulation, and pathways. Quarterly reviews of biophysics Chen, J., Choi, J., O'Leary, S. E., Prabhakar, A., Petrov, A., Grosely, R., Puglisi, E. V., Puglisi, J. D. 2016; 49: e11

    Abstract

    Translation of proteins by the ribosome regulates gene expression, with recent results underscoring the importance of translational control. Misregulation of translation underlies many diseases, including cancer and many genetic diseases. Decades of biochemical and structural studies have delineated many of the mechanistic details in prokaryotic translation, and sketched the outlines of eukaryotic translation. However, translation may not proceed linearly through a single mechanistic pathway, but likely involves multiple pathways and branchpoints. The stochastic nature of biological processes would allow different pathways to occur during translation that are biased by the interaction of the ribosome with other translation factors, with many of the steps kinetically controlled. These multiple pathways and branchpoints are potential regulatory nexus, allowing gene expression to be tuned at the translational level. As research focus shifts toward eukaryotic translation, certain themes will be echoed from studies on prokaryotic translation. This review provides a general overview of the dynamic data related to prokaryotic and eukaryotic translation, in particular recent findings with single-molecule methods, complemented by biochemical, kinetic, and structural findings. We will underscore the importance of viewing the process through the viewpoints of regulation, translational control, and heterogeneous pathways.

    View details for DOI 10.1017/S0033583516000056

    View details for PubMedID 27658712

  • Concentric-flow electrokinetic injector enables serial crystallography of ribosome and photosystem II. Nature methods Sierra, R. G., Gati, C., Laksmono, H., Dao, E. H., Gul, S., Fuller, F., Kern, J., Chatterjee, R., Ibrahim, M., Brewster, A. S., Young, I. D., Michels-Clark, T., Aquila, A., Liang, M., Hunter, M. S., Koglin, J. E., Boutet, S., Junco, E. A., Hayes, B., Bogan, M. J., Hampton, C. Y., Puglisi, E. V., Sauter, N. K., Stan, C. A., Zouni, A., Yano, J., Yachandra, V. K., Soltis, S. M., Puglisi, J. D., DeMirci, H. 2016; 13 (1): 59-62

    Abstract

    We describe a concentric-flow electrokinetic injector for efficiently delivering microcrystals for serial femtosecond X-ray crystallography analysis that enables studies of challenging biological systems in their unadulterated mother liquor. We used the injector to analyze microcrystals of Geobacillus stearothermophilus thermolysin (2.2-Å structure), Thermosynechococcus elongatus photosystem II (<3-Å diffraction) and Thermus thermophilus small ribosomal subunit bound to the antibiotic paromomycin at ambient temperature (3.4-Å structure).

    View details for DOI 10.1038/nmeth.3667

    View details for PubMedID 26619013

    View details for PubMedCentralID PMC4890631

  • The noncoding RNAs SNORD50A and SNORD50B bind K-Ras and are recurrently deleted in human cancer NATURE GENETICS Siprashvili, Z., Webster, D. E., Johnston, D., Shenoy, R. M., Ungewickell, A. J., Bhaduri, A., Flockhart, R., Zarnegar, B. J., Che, Y., Meschi, F., Puglisi, J. D., Khavari, P. A. 2016; 48 (1): 53-?

    Abstract

    Small nucleolar RNAs (snoRNAs) are conserved noncoding RNAs best studied as ribonucleoprotein (RNP) guides in RNA modification. To explore their role in cancer, we compared 5,473 tumor-normal genome pairs to identify snoRNAs with frequent copy number loss. The SNORD50A-SNORD50B snoRNA locus was deleted in 10-40% of 12 common cancers, where its loss was associated with reduced survival. A human protein microarray screen identified direct SNORD50A and SNORD50B RNA binding to K-Ras. Loss of SNORD50A and SNORD50B increased the amount of GTP-bound, active K-Ras and hyperactivated Ras-ERK1/ERK2 signaling. Loss of these snoRNAs also increased binding by farnesyltransferase to K-Ras and increased K-Ras prenylation, suggesting that KRAS mutation might synergize with SNORD50A and SNORD50B loss in cancer. In agreement with this hypothesis, CRISPR-mediated deletion of SNORD50A and SNORD50B in KRAS-mutant tumor cells enhanced tumorigenesis, and SNORD50A and SNORD50B deletion and oncogenic KRAS mutation co-occurred significantly in multiple human tumor types. SNORD50A and SNORD50B snoRNAs thus directly bind and inhibit K-Ras and are recurrently deleted in human cancer.

    View details for DOI 10.1038/ng.3452

    View details for Web of Science ID 000367255300013

    View details for PubMedCentralID PMC5324971

  • Coupling of mRNA Structure Rearrangement to Ribosome Movement during Bypassing of Non-coding Regions. Cell Chen, J., Coakley, A., O'Connor, M., Petrov, A., O'Leary, S. E., Atkins, J. F., Puglisi, J. D. 2015; 163 (5): 1267-1280

    Abstract

    Nearly half of the ribosomes translating a particular bacteriophage T4 mRNA bypass a region of 50 nt, resuming translation 3' of this gap. How this large-scale, specific hop occurs and what determines whether a ribosome bypasses remain unclear. We apply single-molecule fluorescence with zero-mode waveguides to track individual Escherichia coli ribosomes during translation of T4's gene 60 mRNA. Ribosomes that bypass are characterized by a 10- to 20-fold longer pause in a non-canonical rotated state at the take-off codon. During the pause, mRNA secondary structure rearrangements are coupled to ribosome forward movement, facilitated by nascent peptide interactions that disengage the ribosome anticodon-codon interactions for slippage. Close to the landing site, the ribosome then scans mRNA in search of optimal base-pairing interactions. Our results provide a mechanistic and conformational framework for bypassing, highlighting a non-canonical ribosomal state to allow for mRNA structure refolding to drive large-scale ribosome movements.

    View details for DOI 10.1016/j.cell.2015.10.064

    View details for PubMedID 26590426

  • Cotranslational Protein Folding inside the Ribosome Exit Tunnel CELL REPORTS Nilsson, O. B., Hedman, R., Marino, J., Wickles, S., Bischoff, L., Johansson, M., Mueller-Lucks, A., Trovato, F., Puglisi, J. D., O'Brien, E. P., Beckmann, R., Von Heijne, G. 2015; 12 (10): 1533-1540

    Abstract

    At what point during translation do proteins fold? It is well established that proteins can fold cotranslationally outside the ribosome exit tunnel, whereas studies of folding inside the exit tunnel have so far detected only the formation of helical secondary structure and collapsed or partially structured folding intermediates. Here, using a combination of cotranslational nascent chain force measurements, inter-subunit fluorescence resonance energy transfer studies on single translating ribosomes, molecular dynamics simulations, and cryoelectron microscopy, we show that a small zinc-finger domain protein can fold deep inside the vestibule of the ribosome exit tunnel. Thus, for small protein domains, the ribosome itself can provide the kind of sheltered folding environment that chaperones provide for larger proteins.

    View details for DOI 10.1016/j.celrep.2015.07.065

    View details for PubMedID 26321634

  • SYNTHETIC BIOLOGY Ribosomal ties that bind NATURE Puglisi, J. D. 2015; 524 (7563): 45-46

    View details for PubMedID 26222027

  • Protein synthesis. The delicate dance of translation and folding. Science Puglisi, J. D. 2015; 348 (6233): 399-400

    View details for DOI 10.1126/science.aab2157

    View details for PubMedID 25908811

  • RNA dances to center stage RNA-A PUBLICATION OF THE RNA SOCIETY Puglisi, J. D. 2015; 21 (4): 712-713

    View details for DOI 10.1261/rna.051078.115

    View details for PubMedID 25780204

  • A simple real-time assay for in vitro translation. RNA (New York, N.Y.) Capece, M. C., Kornberg, G. L., Petrov, A., Puglisi, J. D. 2015; 21 (2): 296-305

    Abstract

    A high-throughput assay for real-time measurement of translation rates in cell-free protein synthesis (SNAP assay) is described. The SNAP assay enables quantitative, real-time measurement of overall translation rates in vitro via the synthesis of O(6)-alkylguanine DNA O(6)-alkyltransferase (SNAP). SNAP production is continuously detected by fluorescence produced by the reaction of SNAP with a range of quenched fluorogenic substrates. The capabilities of the assay are exemplified by measurements of the activities of Escherichia coli MRE600 ribosomes and fluorescently labeled E. coli mutant ribosomes in the PURExpress translation system and by determination of the 50% inhibitory concentrations (IC50) of three common macrolide antibiotics.

    View details for DOI 10.1261/rna.047159.114

    View details for PubMedID 25525154

  • Single-Molecule Profiling of Ribosome Recoding Phenomena Chen, J., Puglisi, J. D. CELL PRESS. 2015: 391A
  • Kinetic pathway of 40S ribosomal subunit recruitment to hepatitis C virus internal ribosome entry site. Proceedings of the National Academy of Sciences of the United States of America Fuchs, G., Petrov, A. N., Marceau, C. D., Popov, L. M., Chen, J., O'Leary, S. E., Wang, R., Carette, J. E., Sarnow, P., Puglisi, J. D. 2015; 112 (2): 319-325

    Abstract

    Translation initiation can occur by multiple pathways. To delineate these pathways by single-molecule methods, fluorescently labeled ribosomal subunits are required. Here, we labeled human 40S ribosomal subunits with a fluorescent SNAP-tag at ribosomal protein eS25 (RPS25). The resulting ribosomal subunits could be specifically labeled in living cells and in vitro. Using single-molecule Förster resonance energy transfer (FRET) between RPS25 and domain II of the hepatitis C virus (HCV) internal ribosome entry site (IRES), we measured the rates of 40S subunit arrival to the HCV IRES. Our data support a single-step model of HCV IRES recruitment to 40S subunits, irreversible on the initiation time scale. We furthermore demonstrated that after binding, the 40S:HCV IRES complex is conformationally dynamic, undergoing slow large-scale rearrangements. Addition of translation extracts suppresses these fluctuations, funneling the complex into a single conformation on the 80S assembly pathway. These findings show that 40S:HCV IRES complex formation is accompanied by dynamic conformational rearrangements that may be modulated by initiation factors.

    View details for DOI 10.1073/pnas.1421328111

    View details for PubMedID 25516984

  • Real-time observation of signal recognition particle binding to actively translating ribosomes ELIFE Noriega, T. R., Chen, J., Walter, P., Puglisi, J. D. 2014; 3

    Abstract

    The signal recognition particle (SRP) directs translating ribosome-nascent chain complexes (RNCs) that display a signal sequence to protein translocation channels in target membranes. All previous work on the initial step of the targeting reaction, when SRP binds to RNCs, used stalled and non-translating RNCs. This meant that an important dimension of the co-translational process remained unstudied. We apply single-molecule fluorescence measurements to observe directly and in real-time E. coli SRP binding to actively translating RNCs. We show at physiologically relevant SRP concentrations that SRP-RNC association and dissociation rates depend on nascent chain length and the exposure of a functional signal sequence outside the ribosome. Our results resolve a long-standing question: how can a limited, sub-stoichiometric pool of cellular SRP effectively distinguish RNCs displaying a signal sequence from those that are not? The answer is strikingly simple: as originally proposed, SRP only stably engages translating RNCs exposing a functional signal sequence.

    View details for DOI 10.7554/eLife.04418

    View details for Web of Science ID 000344163300004

    View details for PubMedCentralID PMC4213662

  • Dynamic pathways of -1 translational frameshifting. Nature Chen, J., Petrov, A., Johansson, M., Tsai, A., O'Leary, S. E., Puglisi, J. D. 2014; 512 (7514): 328-332

    Abstract

    Spontaneous changes in the reading frame of translation are rare (frequency of 10(-3) to 10(-4) per codon), but can be induced by specific features in the messenger RNA (mRNA). In the presence of mRNA secondary structures, a heptanucleotide 'slippery sequence' usually defined by the motif X XXY YYZ, and (in some prokaryotic cases) mRNA sequences that base pair with the 3' end of the 16S ribosomal rRNA (internal Shine-Dalgarno sequences), there is an increased probability that a specific programmed change of frame occurs, wherein the ribosome shifts one nucleotide backwards into an overlapping reading frame (-1 frame) and continues by translating a new sequence of amino acids. Despite extensive biochemical and genetic studies, there is no clear mechanistic description for frameshifting. Here we apply single-molecule fluorescence to track the compositional and conformational dynamics of individual ribosomes at each codon during translation of a frameshift-inducing mRNA from the dnaX gene in Escherichia coli. Ribosomes that frameshift into the -1 frame are characterized by a tenfold longer pause in elongation compared to non-frameshifted ribosomes, which translate through unperturbed. During the pause, interactions of the ribosome with the mRNA stimulatory elements uncouple EF-G catalysed translocation from normal ribosomal subunit reverse-rotation, leaving the ribosome in a non-canonical intersubunit rotated state with an exposed codon in the aminoacyl-tRNA site (A site). tRNA(Lys) sampling and accommodation to the empty A site and EF-G action either leads to the slippage of the tRNAs into the -1 frame or maintains the ribosome into the 0 frame. Our results provide a general mechanistic and conformational framework for -1 frameshifting, highlighting multiple kinetic branchpoints during elongation.

    View details for DOI 10.1038/nature13428

    View details for PubMedID 24919156

  • Dynamic pathways of-1 translational frameshifting NATURE Chen, J., Petrov, A., Johansson, M., Tsai, A., O'Leary, S. E., Puglisi, J. D. 2014; 512 (7514): 328-?

    Abstract

    Spontaneous changes in the reading frame of translation are rare (frequency of 10(-3) to 10(-4) per codon), but can be induced by specific features in the messenger RNA (mRNA). In the presence of mRNA secondary structures, a heptanucleotide 'slippery sequence' usually defined by the motif X XXY YYZ, and (in some prokaryotic cases) mRNA sequences that base pair with the 3' end of the 16S ribosomal rRNA (internal Shine-Dalgarno sequences), there is an increased probability that a specific programmed change of frame occurs, wherein the ribosome shifts one nucleotide backwards into an overlapping reading frame (-1 frame) and continues by translating a new sequence of amino acids. Despite extensive biochemical and genetic studies, there is no clear mechanistic description for frameshifting. Here we apply single-molecule fluorescence to track the compositional and conformational dynamics of individual ribosomes at each codon during translation of a frameshift-inducing mRNA from the dnaX gene in Escherichia coli. Ribosomes that frameshift into the -1 frame are characterized by a tenfold longer pause in elongation compared to non-frameshifted ribosomes, which translate through unperturbed. During the pause, interactions of the ribosome with the mRNA stimulatory elements uncouple EF-G catalysed translocation from normal ribosomal subunit reverse-rotation, leaving the ribosome in a non-canonical intersubunit rotated state with an exposed codon in the aminoacyl-tRNA site (A site). tRNA(Lys) sampling and accommodation to the empty A site and EF-G action either leads to the slippage of the tRNAs into the -1 frame or maintains the ribosome into the 0 frame. Our results provide a general mechanistic and conformational framework for -1 frameshifting, highlighting multiple kinetic branchpoints during elongation.

    View details for DOI 10.1038/nature13428

    View details for Web of Science ID 000340508200039

    View details for PubMedID 24919156

  • Signal Recognition Particle-ribosome Binding Is Sensitive to Nascent Chain Length. journal of biological chemistry Noriega, T. R., Tsai, A., Elvekrog, M. M., Petrov, A., Neher, S. B., Chen, J., Bradshaw, N., Puglisi, J. D., Walter, P. 2014; 289 (28): 19294-19305

    Abstract

    The signal recognition particle (SRP) directs ribosome-nascent chain complexes (RNCs) displaying signal sequences to protein translocation channels in the plasma membrane of prokaryotes and endoplasmic reticulum of eukaryotes. It was initially proposed that SRP binds the signal sequence when it emerges from an RNC and that successful binding becomes impaired as translation extends the nascent chain, moving the signal sequence away from SRP on the ribosomal surface. Later studies drew this simple model into question, proposing that SRP binding is unaffected by nascent chain length. Here, we reinvestigate this issue using two novel and independent fluorescence resonance energy transfer assays. We show that the arrival and dissociation rates of SRP binding to RNCs vary according to nascent chain length, resulting in the highest affinity shortly after a functional signal sequence emerges from the ribosome. Moreover, we show that SRP binds RNCs in multiple and interconverting conformations, and that conversely, RNCs exist in two conformations distinguished by SRP interaction kinetics.

    View details for DOI 10.1074/jbc.M114.563239

    View details for PubMedID 24808175

  • The Dynamics of SecM-Induced Translational Stalling CELL REPORTS Tsai, A., Kornberg, G., Johansson, M., Chen, J., Puglisi, J. D. 2014; 7 (5): 1521-1533

    Abstract

    SecM is an E. coli secretion monitor capable of stalling translation on the prokaryotic ribosome without cofactors. Biochemical and structural studies have demonstrated that the SecM nascent chain interacts with the 50S subunit exit tunnel to inhibit peptide bond formation. However, the timescales and pathways of stalling on an mRNA remain undefined. To provide a dynamic mechanism for stalling, we directly tracked the dynamics of elongation on ribosomes translating the SecM stall sequence (FSTPVWISQAQGIRAGP) using single-molecule fluorescence techniques. Within 1 min, three peptide-ribosome interactions work cooperatively over the last five codons of the SecM sequence, leading to severely impaired elongation rates beginning from the terminal proline and lasting four codons. Our results suggest that stalling is tightly linked to the dynamics of elongation and underscore the roles that the exit tunnel and nascent chain play in controlling fundamental steps in translation.

    View details for DOI 10.1016/j.celrep.2014.04.033

    View details for Web of Science ID 000338324200019

    View details for PubMedCentralID PMC4059775

  • Sequence-dependent elongation dynamics on macrolide-bound ribosomes. Cell reports Johansson, M., Chen, J., Tsai, A., Kornberg, G., Puglisi, J. D. 2014; 7 (5): 1534-46

    Abstract

    The traditional view of macrolide antibiotics as plugs inside the ribosomal nascent peptide exit tunnel (NPET) has lately been challenged in favor of a more complex, heterogeneous mechanism, where drug-peptide interactions determine the fate of a translating ribosome. To investigate these highly dynamic processes, we applied single-molecule tracking of elongating ribosomes during inhibition of elongation by erythromycin of several nascent chains, including ErmCL and H-NS, which were shown to be, respectively, sensitive and resistant to erythromycin. Peptide sequence-specific changes were observed in translation elongation dynamics in the presence of a macrolide-obstructed NPET. Elongation rates were not severely inhibited in general by the presence of the drug; instead, stalls or pauses were observed as abrupt events. The dynamic pathways of nascent-chain-dependent elongation pausing in the presence of macrolides determine the fate of the translating ribosome stalling or readthrough.

    View details for DOI 10.1016/j.celrep.2014.04.034

    View details for PubMedID 24836000

  • The Dynamics of SecM-Induced Translational Stalling. Cell reports Tsai, A., Kornberg, G., Johansson, M., Chen, J., Puglisi, J. D. 2014; 7 (5): 1521-33

    Abstract

    SecM is an E. coli secretion monitor capable of stalling translation on the prokaryotic ribosome without cofactors. Biochemical and structural studies have demonstrated that the SecM nascent chain interacts with the 50S subunit exit tunnel to inhibit peptide bond formation. However, the timescales and pathways of stalling on an mRNA remain undefined. To provide a dynamic mechanism for stalling, we directly tracked the dynamics of elongation on ribosomes translating the SecM stall sequence (FSTPVWISQAQGIRAGP) using single-molecule fluorescence techniques. Within 1 min, three peptide-ribosome interactions work cooperatively over the last five codons of the SecM sequence, leading to severely impaired elongation rates beginning from the terminal proline and lasting four codons. Our results suggest that stalling is tightly linked to the dynamics of elongation and underscore the roles that the exit tunnel and nascent chain play in controlling fundamental steps in translation.

    View details for DOI 10.1016/j.celrep.2014.04.033

    View details for PubMedID 24836001

    View details for PubMedCentralID PMC4059775

  • Sequence-Dependent Elongation Dynamics on Macrolide-Bound Ribosomes CELL REPORTS Johansson, M., Chen, J., Tsai, A., Kornberg, G., Puglisi, J. D. 2014; 7 (5): 1534-1546

    Abstract

    The traditional view of macrolide antibiotics as plugs inside the ribosomal nascent peptide exit tunnel (NPET) has lately been challenged in favor of a more complex, heterogeneous mechanism, where drug-peptide interactions determine the fate of a translating ribosome. To investigate these highly dynamic processes, we applied single-molecule tracking of elongating ribosomes during inhibition of elongation by erythromycin of several nascent chains, including ErmCL and H-NS, which were shown to be, respectively, sensitive and resistant to erythromycin. Peptide sequence-specific changes were observed in translation elongation dynamics in the presence of a macrolide-obstructed NPET. Elongation rates were not severely inhibited in general by the presence of the drug; instead, stalls or pauses were observed as abrupt events. The dynamic pathways of nascent-chain-dependent elongation pausing in the presence of macrolides determine the fate of the translating ribosome stalling or readthrough.

    View details for DOI 10.1016/j.celrep.2014.04.034

    View details for Web of Science ID 000338324200020

  • Single-Molecule Profiling of Ribosome Translational Phenomena Chen, J., Petrov, A., Johansson, M., Tsai, A., O'Leary, S. E., Puglisi, J. D. CELL PRESS. 2014: 239A
  • RNA Structural Rearrangements during Reverse Transcription Initiation in HIV Coey, A., Mpossi, M., Viani-Puglisi, E., Puglisi, J. CELL PRESS. 2014: 280A
  • High-throughput platform for real-time monitoring of biological processes by multicolor single-molecule fluorescence PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA Chen, J., Dalal, R. V., Petrov, A. N., Tsai, A., O'Leary, S. E., Chapin, K., Cheng, J., Ewan, M., Hsiung, P., Lundquist, P., Turner, S. W., Hsu, D. R., Puglisi, J. D. 2014; 111 (2): 664-669

    Abstract

    Zero-mode waveguides provide a powerful technology for studying single-molecule real-time dynamics of biological systems at physiological ligand concentrations. We customized a commercial zero-mode waveguide-based DNA sequencer for use as a versatile instrument for single-molecule fluorescence detection and showed that the system provides long fluorophore lifetimes with good signal to noise and low spectral cross-talk. We then used a ribosomal translation assay to show real-time fluidic delivery during data acquisition, showing it is possible to follow the conformation and composition of thousands of single biomolecules simultaneously through four spectral channels. This instrument allows high-throughput multiplexed dynamics of single-molecule biological processes over long timescales. The instrumentation presented here has broad applications to single-molecule studies of biological systems and is easily accessible to the biophysical community.

    View details for DOI 10.1073/pnas.1315735111

    View details for PubMedID 24379388

  • Real-time observation of signal recognition particle binding to actively translating ribosomes. eLife Noriega, T. R., Chen, J., Walter, P., Puglisi, J. D. 2014; 3

    Abstract

    The signal recognition particle (SRP) directs translating ribosome-nascent chain complexes (RNCs) that display a signal sequence to protein translocation channels in target membranes. All previous work on the initial step of the targeting reaction, when SRP binds to RNCs, used stalled and non-translating RNCs. This meant that an important dimension of the co-translational process remained unstudied. We apply single-molecule fluorescence measurements to observe directly and in real-time E. coli SRP binding to actively translating RNCs. We show at physiologically relevant SRP concentrations that SRP-RNC association and dissociation rates depend on nascent chain length and the exposure of a functional signal sequence outside the ribosome. Our results resolve a long-standing question: how can a limited, sub-stoichiometric pool of cellular SRP effectively distinguish RNCs displaying a signal sequence from those that are not? The answer is strikingly simple: as originally proposed, SRP only stably engages translating RNCs exposing a functional signal sequence.

    View details for DOI 10.7554/eLife.04418

    View details for PubMedID 25358118

  • Dynamic Recognition of the mRNA Cap by Saccharomyces cerevisiae eIF4E STRUCTURE O'Leary, S. E., Petrov, A., Chen, J., Puglisi, J. D. 2013; 21 (12): 2197-2207

    Abstract

    Recognition of the mRNA 5' m⁷G(5')ppp(5')N cap is key to translation initiation for most eukaryotic mRNAs. The cap is bound by the eIF4F complex, consisting of a cap-binding protein (eIF4E), a "scaffold" protein (eIF4G), and an RNA helicase (eIF4A). As a central early step in initiation, regulation of eIF4F is crucial for cellular viability. Although the structure and function of eIF4E have been defined, a dynamic mechanistic picture of its activity at the molecular level in the eIF4F·mRNA complex is still unavailable. Here, using single-molecule fluorescence, we measured the effects of Saccharomyces cerevisiae eIF4F factors, mRNA secondary structure, and the poly(A)-binding protein Pab1p on eIF4E-mRNA binding dynamics. Our data provide an integrated picture of how eIF4G and mRNA structure modulate eIF4E-mRNA interaction, and uncover an eIF4G- and poly(A)-independent activity of poly(A)-binding protein that prolongs the eIF4E·mRNA complex lifetime.

    View details for DOI 10.1016/j.str.2013.09.016

    View details for PubMedID 24183571

  • Involvement of protein IF2 N domain in ribosomal subunit joining revealed from architecture and function of the full-length initiation factor PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA Simonetti, A., Marzi, S., Billas, I. M., Tsai, A., Fabbretti, A., Myasnikov, A. G., Roblin, P., Vaiana, A. C., Hazemann, I., Eiler, D., Steitz, T. A., Puglisi, J. D., Gualerzi, C. O., Klaholz, B. P. 2013; 110 (39): 15656-15661

    Abstract

    Translation initiation factor 2 (IF2) promotes 30S initiation complex (IC) formation and 50S subunit joining, which produces the 70S IC. The architecture of full-length IF2, determined by small angle X-ray diffraction and cryo electron microscopy, reveals a more extended conformation of IF2 in solution and on the ribosome than in the crystal. The N-terminal domain is only partially visible in the 30S IC, but in the 70S IC, it stabilizes interactions between IF2 and the L7/L12 stalk of the 50S, and on its deletion, proper N-formyl-methionyl(fMet)-tRNA(fMet) positioning and efficient transpeptidation are affected. Accordingly, fast kinetics and single-molecule fluorescence data indicate that the N terminus promotes 70S IC formation by stabilizing the productive sampling of the 50S subunit during 30S IC joining. Together, our data highlight the dynamics of IF2-dependent ribosomal subunit joining and the role played by the N terminus of IF2 in this process.

    View details for DOI 10.1073/pnas.1309578110

    View details for Web of Science ID 000324765100040

    View details for PubMedID 24029017

    View details for PubMedCentralID PMC3785770

  • Coordinated conformational and compositional dynamics drive ribosome translocation. Nature structural & molecular biology Chen, J., Petrov, A., Tsai, A., O'Leary, S. E., Puglisi, J. D. 2013; 20 (6): 718-727

    Abstract

    During translation elongation, the ribosome compositional factors elongation factor G (EF-G; encoded by fusA) and tRNA alternately bind to the ribosome to direct protein synthesis and regulate the conformation of the ribosome. Here, we use single-molecule fluorescence with zero-mode waveguides to directly correlate ribosome conformation and composition during multiple rounds of elongation at high factor concentrations in Escherichia coli. Our results show that EF-G bound to GTP (EF-G-GTP) continuously samples both rotational states of the ribosome, binding with higher affinity to the rotated state. Upon successful accommodation into the rotated ribosome, the EF-G-ribosome complex evolves through several rate-limiting conformational changes and the hydrolysis of GTP, which results in a transition back to the nonrotated state and in turn drives translocation and facilitates release of both EF-G-GDP and E-site tRNA. These experiments highlight the power of tracking single-molecule conformation and composition simultaneously in real time.

    View details for DOI 10.1038/nsmb.2567

    View details for PubMedID 23624862

  • Coordinated conformational and compositional dynamics drive ribosome translocation. Nature structural & molecular biology Chen, J., Petrov, A., Tsai, A., O'Leary, S. E., Puglisi, J. D. 2013; 20 (6): 718-727

    Abstract

    During translation elongation, the ribosome compositional factors elongation factor G (EF-G; encoded by fusA) and tRNA alternately bind to the ribosome to direct protein synthesis and regulate the conformation of the ribosome. Here, we use single-molecule fluorescence with zero-mode waveguides to directly correlate ribosome conformation and composition during multiple rounds of elongation at high factor concentrations in Escherichia coli. Our results show that EF-G bound to GTP (EF-G-GTP) continuously samples both rotational states of the ribosome, binding with higher affinity to the rotated state. Upon successful accommodation into the rotated ribosome, the EF-G-ribosome complex evolves through several rate-limiting conformational changes and the hydrolysis of GTP, which results in a transition back to the nonrotated state and in turn drives translocation and facilitates release of both EF-G-GDP and E-site tRNA. These experiments highlight the power of tracking single-molecule conformation and composition simultaneously in real time.

    View details for DOI 10.1038/nsmb.2567

    View details for PubMedID 23624862

  • The Impact of Aminoglycosides on the Dynamics of Translation Elongation CELL REPORTS Tsai, A., Uemura, S., Johansson, M., Puglisi, E. V., Marshall, R. A., Aitken, C. E., Korlach, J., Ehrenberg, M., Puglisi, J. D. 2013; 3 (2): 497-508

    Abstract

    Inferring antibiotic mechanisms on translation through static structures has been challenging, as biological systems are highly dynamic. Dynamic single-molecule methods are also limited to few simultaneously measurable parameters. We have circumvented these limitations with a multifaceted approach to investigate three structurally distinct aminoglycosides that bind to the aminoacyl-transfer RNA site (A site) in the prokaryotic 30S ribosomal subunit: apramycin, paromomycin, and gentamicin. Using several single-molecule fluorescence measurements combined with structural and biochemical techniques, we observed distinct changes to translational dynamics for each aminoglycoside. While all three drugs effectively inhibit translation elongation, their actions are structurally and mechanistically distinct. Apramycin does not displace A1492 and A1493 at the decoding center, as demonstrated by a solution nuclear magnetic resonance structure, causing only limited miscoding; instead, it primarily blocks translocation. Paromomycin and gentamicin, which displace A1492 and A1493, cause significant miscoding, block intersubunit rotation, and inhibit translocation. Our results show the power of combined dynamics, structural, and biochemical approaches to elucidate the complex mechanisms underlying translation and its inhibition.

    View details for DOI 10.1016/j.celrep.2013.01.027

    View details for PubMedID 23416053

  • Observing Prokaryotic Translation Elongation in Real-Time using Single-Molecule Fluorescence 57th Annual Meeting of the Biophysical-Society Tsai, A., Chen, J., Kornberg, G., Korlach, J., Uemura, S., Puglisi, J. CELL PRESS. 2013: 257A–257A
  • Coordinated Conformational and Compositional Dynamics Drive Ribosome Translocation Chen, J., Petrov, A., Sean, A., O'Leary, E., Puglisi, J. D. CELL PRESS. 2013: 260A
  • Analysis of RNA by analytical polyacrylamide gel electrophoresis. Methods in enzymology Petrov, A., Tsa, A., Puglisi, J. D. 2013; 530: 301-313

    Abstract

    Polyacrylamide gel electrophoresis (PAGE) is a powerful tool for analyzing RNA samples. Denaturing PAGE provides information on the sample composition and structural integrity of the individual RNA species. Nondenaturing gel electrophoresis allows separation of the conformers and alternatively folded RNA species. It also can be used to resolve RNA protein complexes and to detect RNA complex formation by analyzing changes in the electrophoretic mobility of the RNA. RNA can be visualized within gels by different methods depending on the nature of the detection reagent. RNA molecules can be stained with various dyes, including toluidine blue, SYBR green, and ethidium bromide. Radioactively labeled RNA molecules are visualized by autoradiography, and fluorescently labeled RNA molecules can be observed with a fluorescence scanner. Generally, gels between 0.4 and 1.5mm thick are used for analytical PAGE. Gels thinner than 1mm are fragile and thus usually are not stained but rather are used for radiolabeled RNA. The gels are dried and the radiolabeled RNA is visualized by autoradiography.

    View details for DOI 10.1016/B978-0-12-420037-1.00016-6

    View details for PubMedID 24034328

  • RNA purification by preparative polyacrylamide gel electrophoresis. Methods in enzymology Petrov, A., Wu, T., Puglisi, E. V., Puglisi, J. D. 2013; 530: 315-330

    Abstract

    Preparative polyacrylamide gel electrophoresis (PAGE) is a powerful tool for purifying RNA samples. Denaturing PAGE allows separation of nucleic acids that differ by a single nucleotide in length. It is commonly used to separate and purify RNA species after in vitro transcription, to purify naturally occurring RNA variants such as tRNAs, to remove degradation products, and to purify labeled RNA species. To preserve RNA integrity following purification, RNA is usually visualized by UV shadowing or stained with ethidium bromide or SYBR green dyes.

    View details for DOI 10.1016/B978-0-12-420037-1.00017-8

    View details for PubMedID 24034329

  • Unraveling the dynamics of ribosome translocation CURRENT OPINION IN STRUCTURAL BIOLOGY Chen, J., Tsai, A., O'Leary, S. E., Petrov, A., Puglisi, J. D. 2012; 22 (6): 804-814

    Abstract

    Translocation is one of the key events in translation, requiring large-scale conformational changes in the ribosome, movements of two transfer RNAs (tRNAs) across a distance of more than 20Å, and the coupled movement of the messenger RNA (mRNA) by one codon, completing one cycle of peptide-chain elongation. Translocation is catalyzed by elongation factor G (EF-G in bacteria), which hydrolyzes GTP in the process. However, how the conformational rearrangements of the ribosome actually drive the movements of the tRNAs and how EF-G GTP hydrolysis plays a role in this process are still unclear. Fluorescence methods, both single-molecule and bulk, have provided a dynamic view of translocation, allowing us to follow the different conformational changes of the ribosome in real-time. The application of electron microscopy has revealed new conformational intermediates during translocation and important structural rearrangements in the ribosome that drive tRNA movement, while computational approaches have added quantitative views of the translational pathway. These recent advances shed light on the process of translocation, providing insight on how to resolve the different descriptions of translocation in the current literature.

    View details for DOI 10.1016/j.sbi.2012.09.004

    View details for PubMedID 23142574

  • Single-Molecule Analysis of Translational Dynamics COLD SPRING HARBOR PERSPECTIVES IN BIOLOGY Petrov, A., Chen, J., O'Leary, S., Tsai, A., Puglisi, J. D. 2012; 4 (9)

    Abstract

    Decades of extensive biochemical and biophysical research have outlined the mechanism of translation. Rich structural studies have provided detailed snapshots of the translational machinery at all phases of the translation cycle. However, the relationship between structural dynamics, composition, and function remains unknown. The multistep nature of each stage of the translation cycle results in rapid desynchronization of individual ribosomes, thus hindering elucidation of the underlying mechanisms by conventional bulk biophysical and biochemical methods. Single-molecule approaches unsusceptible to these complications have led to the first glances at both compositional and conformational dynamics on the ribosome and their impact on translational control. These experiments provide the necessary link between static structure and mechanism, often providing new perspectives. Here we review recent advances in the field and their relationship to structural and biochemical data.

    View details for DOI 10.1101/cshperspect.a011551

    View details for PubMedID 22798542

  • Precursor Directed Biosynthesis of an Orthogonally Functional Erythromycin Analogue: Selectivity in the Ribosome Macrolide Binding Pocket JOURNAL OF THE AMERICAN CHEMICAL SOCIETY Harvey, C. J., Puglisi, J. D., Pande, V. S., Cane, D. E., Khosla, C. 2012; 134 (29): 12259-12265

    Abstract

    The macrolide antibiotic erythromycin A and its semisynthetic analogues have been among the most useful antibacterial agents for the treatment of infectious diseases. Using a recently developed chemical genetic strategy for precursor-directed biosynthesis and colony bioassay of 6-deoxyerythromycin D analogues, we identified a new class of alkynyl- and alkenyl-substituted macrolides with activities comparable to that of the natural product. Further analysis revealed a marked and unexpected dependence of antibiotic activity on the size and degree of unsaturation of the precursor. Based on these leads, we also report the precursor-directed biosynthesis of 15-propargyl erythromycin A, a novel antibiotic that not only is as potent as erythromycin A with respect to its ability to inhibit bacterial growth and cell-free ribosomal protein biosynthesis but also harbors an orthogonal functional group that is capable of facile chemical modification.

    View details for DOI 10.1021/ja304682q

    View details for PubMedID 22741553

  • Heterogeneous pathways and timing of factor departure during translation initiation NATURE Tsai, A., Petrov, A., Marshall, R. A., Korlach, J., Uemura, S., Puglisi, J. D. 2012; 487 (7407): 390-394

    Abstract

    The initiation of translation establishes the reading frame for protein synthesis and is a key point of regulation. Initiation involves factor-driven assembly at a start codon of a messenger RNA of an elongation-competent 70S ribosomal particle (in bacteria) from separated 30S and 50S subunits and initiator transfer RNA. Here we establish in Escherichia coli, using direct single-molecule tracking, the timing of initiator tRNA, initiation factor 2 (IF2; encoded by infB) and 50S subunit joining during initiation. Our results show multiple pathways to initiation, with orders of arrival of tRNA and IF2 dependent on factor concentration and composition. IF2 accelerates 50S subunit joining and stabilizes the assembled 70S complex. Transition to elongation is gated by the departure of IF2 after GTP hydrolysis, allowing efficient arrival of elongator tRNAs to the second codon presented in the aminoacyl-tRNA binding site (A site). These experiments highlight the power of single-molecule approaches to delineate mechanisms in complex multicomponent systems.

    View details for DOI 10.1038/nature11172

    View details for PubMedID 22722848

  • Digging deep into nucleic acid structure and nucleic acid protein recognition CURRENT OPINION IN STRUCTURAL BIOLOGY Puglisi, J. D., Williamson, J. R. 2012; 22 (3): 249-250

    View details for DOI 10.1016/j.sbi.012.05.003

    View details for Web of Science ID 000306347800001

    View details for PubMedID 22632873

  • Nonfluorescent Quenchers To Correlate Single-Molecule Conformational and Compositional Dynamics JOURNAL OF THE AMERICAN CHEMICAL SOCIETY Chen, J., Tsai, A., Petrov, A., Puglisi, J. D. 2012; 134 (13): 5734-5737

    Abstract

    Single-molecule Förster resonance energy transfer (smFRET) is a powerful method for studying the conformational dynamics of a biomolecule in real-time. However, studying how interacting ligands correlate with and regulate the conformational dynamics of the biomolecule is extremely challenging because of the availability of a limited number of fluorescent dyes with both high quantum yield and minimal spectral overlap. Here we report the use of a nonfluorescent quencher (Black Hole Quencher, BHQ) as an acceptor for smFRET. Using a Cy3/BHQ pair, we can accurately follow conformational changes of the ribosome during elongation in real time. We demonstrate the application of single-color FRET to correlate the conformational dynamics of the ribosome with the compositional dynamics of tRNA. We use the normal Cy5 FRET acceptor to observe arrival of a fluorescently labeled tRNA with a concomitant transition of the ribosome from the locked to the unlocked conformation. Our results illustrate the potential of nonfluorescent quenchers in single-molecule correlation studies.

    View details for DOI 10.1021/ja2119964

    View details for PubMedID 22428667

  • Real-Time Dynamics of Translation Experimental Biology Meeting 2012 Puglisi, J. D., Chen, J., Kornberg, G., O'Leary, S., Petrov, A., Tsai, A. FEDERATION AMER SOC EXP BIOL. 2012
  • Initiation factor 2, tRNA, and 50S subunits cooperatively stabilize mRNAs on the ribosome during initiation PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA Masuda, T., Petrov, A. N., Iizuka, R., Funatsu, T., Puglisi, J. D., Uemura, S. 2012; 109 (13): 4881-4885

    Abstract

    Initiation factor 2 (IF2) is a key factor in initiation of bacterial protein synthesis. It recruits initiator tRNA to the small ribosomal subunit and facilitates joining of the large ribosomal subunit. Using reconstituted translation system of Escherichia coli and optical tweezers, we directly measure the rupture force between single ribosomal complexes and mRNAs for initiation complexes in the presence and the absence of IF2. We demonstrate that IF2 together with codon recognition by initiator tRNA increases the force required to dislocate mRNA from the ribosome complexes; mRNA stabilization by IF2 required the presence of a joined 50S subunit, and was independent of bound guanine nucleotide. IF2 thus helps lock the 70S ribosome over the start codon during initiation, thus maintaining reading frame. Our results show how mRNA is progressively stabilized on the ribosome through distinct steps of initiation.

    View details for DOI 10.1073/pnas.1118452109

    View details for Web of Science ID 000302164200039

    View details for PubMedID 22411833

    View details for PubMedCentralID PMC3323968

  • Secondary Structure of the HIV Reverse Transcription Initiation Complex by NMR JOURNAL OF MOLECULAR BIOLOGY Puglisi, E. V., Puglisi, J. D. 2011; 410 (5): 863-874

    Abstract

    Initiation of reverse transcription of genomic RNA is a key early step in replication of the human immunodeficiency virus (HIV) upon infection of a host cell. Viral reverse transcriptase initiates from a specific RNA-RNA complex formed between a host transfer RNA (tRNA(Lys)(3)) and a region at the 5' end of genomic RNA; the 3' end of the tRNA acts as a primer for reverse transcription of genomic RNA. We report here the secondary structure of the HIV genomic RNA-human tRNA(Lys)(3) initiation complex using heteronuclear nuclear magnetic resonance methods. We show that both RNAs undergo large-scale conformational changes upon complex formation. Formation of the 18-bp primer helix with the 3' end of tRNA(Lys)(3) drives large conformational rearrangements of the tRNA at the 5' end while maintaining the anticodon loop for potential loop-loop interactions. HIV RNA forms an intramolecular helix adjacent to the intermolecular primer helix. This helix, which must be broken by reverse transcription, likely acts as a kinetic block to reverse transcription.

    View details for DOI 10.1016/j.jmb.2011.04.024

    View details for PubMedID 21763492

  • Dynamics of the translational machinery CURRENT OPINION IN STRUCTURAL BIOLOGY Petrov, A., Kornberg, G., O'Leary, S., Tsai, A., Uemura, S., Puglisi, J. D. 2011; 21 (1): 137-145

    Abstract

    The recent growth in single molecule studies of translation has provided an insight into the molecular mechanism of ribosomal function. Single molecule fluorescence approaches allowed direct observation of the structural rearrangements occurring during translation and revealed dynamic motions of the ribosome and its ligands. These studies demonstrated how ligand binding affects dynamics of the ribosome, and the role of the conformational sampling in large-scale rearrangements intrinsic to translation elongation. The application of time-resolved cryo-electron microscopy revealed new conformational intermediates during back-translocation providing an insight into ribosomal dynamics from an alternative perspective. Recent developments permitted examination of conformational and compositional dynamics of the ribosome in real-time through multiple cycles of elongation at the single molecule level. The zero-mode waveguide approach allowed direct observation of the compositional dynamics of tRNA occupancy on the elongating ribosome. The emergence of single molecule in vivo techniques provided insights into the mechanism and regulation of translation at the organismal level.

    View details for DOI 10.1016/j.sbi.2010.11.007

    View details for PubMedID 21256733

  • Real-time monitoring of single-molecule translation 2010 Ribosome Meeting Uemura, S., Puglisi, J. D. SPRINGER-VERLAG WIEN. 2011: 295–302
  • Site-specific labeling of Saccharomyces cerevisiae ribosomes for single-molecule manipulations NUCLEIC ACIDS RESEARCH Petrov, A., Puglisi, J. D. 2010; 38 (13)

    Abstract

    Site-specific labeling of Escherichia coli ribosomes has allowed application of single-molecule fluorescence spectroscopy and force methods to probe the mechanism of translation. To apply these approaches to eukaryotic translation, eukaryotic ribosomes must be specifically labeled with fluorescent labels and molecular handles. Here, we describe preparation and labeling of the small and large yeast ribosomal subunits. Phylogenetically variable hairpin loops in ribosomal RNA are mutated to allow hybridization of oligonucleotides to mutant ribosomes. We demonstrate specific labeling of the ribosomal subunits, and their use in single-molecule fluorescence and force experiments.

    View details for DOI 10.1093/nar/gkq390

    View details for PubMedID 20501598

  • Following the intersubunit conformation of the ribosome during translation in real time NATURE STRUCTURAL & MOLECULAR BIOLOGY Aitken, C. E., Puglisi, J. D. 2010; 17 (7): 793-U35

    Abstract

    We report the direct observation of conformational rearrangements of the ribosome during multiple rounds of elongation. Using single-molecule fluorescence resonance energy transfer, we monitored the intersubunit conformation of the ribosome in real time as it proceeds from codon to codon. During each elongation cycle, the ribosome unlocks upon peptide bond formation, then reverts to the locked state upon translocation onto the next codon. Our data reveal both the specific and cumulative effects of antibiotics on individual steps of translation and uncover the processivity of the ribosome as it elongates. Our approach interrogates the precise molecular events occurring at each codon of the mRNA within the full context of ongoing translation.

    View details for DOI 10.1038/nsmb.1828

    View details for PubMedID 20562856

  • Nucleic acids continue to surprise Editorial overview CURRENT OPINION IN STRUCTURAL BIOLOGY Puglisi, J. D., Williamson, J. R. 2010; 20 (3): 259-261

    View details for DOI 10.1016/j.sbi.2010.04.005

    View details for Web of Science ID 000279061300001

    View details for PubMedID 20510604

  • Real-time tRNA transit on single translating ribosomes at codon resolution NATURE Uemura, S., Aitken, C. E., Korlach, J., Flusberg, B. A., Turner, S. W., Puglisi, J. D. 2010; 464 (7291): 1012-U73

    Abstract

    Translation by the ribosome occurs by a complex mechanism involving the coordinated interaction of multiple nucleic acid and protein ligands. Here we use zero-mode waveguides (ZMWs) and sophisticated detection instrumentation to allow real-time observation of translation at physiologically relevant micromolar ligand concentrations. Translation at each codon is monitored by stable binding of transfer RNAs (tRNAs)-labelled with distinct fluorophores-to translating ribosomes, which allows direct detection of the identity of tRNA molecules bound to the ribosome and therefore the underlying messenger RNA (mRNA) sequence. We observe the transit of tRNAs on single translating ribosomes and determine the number of tRNA molecules simultaneously bound to the ribosome, at each codon of an mRNA molecule. Our results show that ribosomes are only briefly occupied by two tRNA molecules and that release of deacylated tRNA from the exit (E) site is uncoupled from binding of aminoacyl-tRNA site (A-site) tRNA and occurs rapidly after translocation. The methods outlined here have broad application to the study of mRNA sequences, and the mechanism and regulation of translation.

    View details for DOI 10.1038/nature08925

    View details for PubMedID 20393556

  • Ligand-specific regulation of the extracellular surface of a G-protein-coupled receptor NATURE Bokoch, M. P., Zou, Y., Rasmussen, S. G., Liu, C. W., Nygaard, R., Rosenbaum, D. M., Fung, J. J., Choi, H., Thian, F. S., Kobilka, T. S., Puglisi, J. D., Weis, W. I., Pardo, L., Prosser, R. S., Mueller, L., Kobilka, B. K. 2010; 463 (7277): 108-U121

    Abstract

    G-protein-coupled receptors (GPCRs) are seven-transmembrane proteins that mediate most cellular responses to hormones and neurotransmitters. They are the largest group of therapeutic targets for a broad spectrum of diseases. Recent crystal structures of GPCRs have revealed structural conservation extending from the orthosteric ligand-binding site in the transmembrane core to the cytoplasmic G-protein-coupling domains. In contrast, the extracellular surface (ECS) of GPCRs is remarkably diverse and is therefore an ideal target for the discovery of subtype-selective drugs. However, little is known about the functional role of the ECS in receptor activation, or about conformational coupling of this surface to the native ligand-binding pocket. Here we use NMR spectroscopy to investigate ligand-specific conformational changes around a central structural feature in the ECS of the beta(2) adrenergic receptor: a salt bridge linking extracellular loops 2 and 3. Small-molecule drugs that bind within the transmembrane core and exhibit different efficacies towards G-protein activation (agonist, neutral antagonist and inverse agonist) also stabilize distinct conformations of the ECS. We thereby demonstrate conformational coupling between the ECS and the orthosteric binding site, showing that drugs targeting this diverse surface could function as allosteric modulators with high subtype selectivity. Moreover, these studies provide a new insight into the dynamic behaviour of GPCRs not addressable by static, inactive-state crystal structures.

    View details for DOI 10.1038/nature08650

    View details for PubMedID 20054398

  • Single Ribosome Dynamics and the Mechanism of Translation ANNUAL REVIEW OF BIOPHYSICS, VOL 39 Aitken, C. E., Petrov, A., Puglisi, J. D. 2010; 39: 491-513

    Abstract

    Our current understanding of the mechanism of translation is based on nearly fifty years of biochemical and biophysical studies. This mechanism, which requires the ribosome to manipulate tRNA and step repetitively along the mRNA, implies movement. High-resolution structures of the ribosome and its ligands have recently described translation in atomic detail, capturing the endpoints of large-scale rearrangements of the ribosome. Direct observation of the dynamic events that underlie the mechanism of translation is challenged by ensemble averaging in bulk solutions. Single-molecule methods, which eliminate these averaging effects, have emerged as powerful tools to probe the mechanism of translation. Single-molecule fluorescence experiments have described the dynamic motion of the ribosome and tRNA. Single-molecule force measurements have directly probed the forces stabilizing ribosomal complexes. Recent developments have allowed real-time observation of ribosome movement and dynamics during translation. This review covers the contributions of single-molecule studies to our understanding of the dynamic nature of translation.

    View details for DOI 10.1146/annurev.biophys.093008.131427

    View details for PubMedID 20192783

  • Realtime Observation of tRNA Dynamics at High Concentrations in Single Molecule Translation Uemura, S., Korlach, J., Flusberg, B., Turner, S., Puglisi, J. D. CELL PRESS. 2010: 260A–261A
  • Resolving the Elegant Architecture of the Ribosome MOLECULAR CELL Puglisi, J. D. 2009; 36 (5): 720-723

    Abstract

    This year's Nobel Prize in Chemistry rewards Ada Yonath, Tom Steitz, and Venki Ramakrishnan for their groundbreaking structural studies on the ribosome.

    View details for DOI 10.1016/j.molcel.2009.11.031

    View details for PubMedID 20005832

  • The Anti-Hepatitis C Agent Nitazoxanide Induces Phosphorylation of Eukaryotic Initiation Factor 2 alpha Via Protein Kinase Activated by Double-Stranded RNA Activation GASTROENTEROLOGY Elazar, M., Liu, M., Mckenna, S. A., Liu, P., Gehrig, E. A., Puglisi, J. D., Rossignol, J., Glenn, J. S. 2009; 137 (5): 1827-1835

    Abstract

    New therapies are needed to treat patients infected with hepatitis C virus (HCV), a major worldwide cause of chronic liver disease. Nitazoxanide (NTZ), originally used to treat cryptosporidiosis infection, recently was shown to have unexpected antiviral activity in the HCV replicon system and in chronically infected patients. A pilot clinical study suggested that NTZ can augment the antiviral effect of interferon (IFN), although the molecular basis for its effect was unknown.We analyzed the effects of NTZ on the regulation of eukaryotic initiation factor-2alpha (eIF2alpha) and its IFN-induced kinase, protein kinase activated by double-stranded RNA (PKR), in cells that support HCV RNA replication and in vitro biochemical assays.NTZ increased eIF2alpha phosphorylation, a modification known to mediate host cell antiviral defenses. The addition of IFN to cell cultures increased NTZ-induced eIF2alpha phosphorylation. NTZ also increased PKR phosphorylation. In vitro, NTZ promoted PKR autophosphorylation, a key step in activating PKR's kinase activity for eIF2alpha. Finally, NTZ-induced eIF2alpha phosphorylation was reduced in the presence of specific inhibitors of PKR autophosphorylation.An important mechanism of NTZ's action involves activation of PKR, a key kinase that regulates the cell's innate antiviral response. These observations could explain the clinical antiviral effect of NTZ. NTZ might represent a new class of small molecules capable of potentiating and recapitulating important antiviral effects of IFN.

    View details for DOI 10.1053/j.gastro.2009.07.056

    View details for PubMedID 19664635

  • Translational insensitivity to potent activation of PKR by HCV IRES RNA ANTIVIRAL RESEARCH Shimoike, T., Mckenna, S. A., Lindhout, D. A., Puglisi, J. D. 2009; 83 (3): 228-237

    Abstract

    Translation of hepatitis C virus (HCV) is initiated at an internal ribosome entry site (IRES) located at the 5'end of its RNA genome. The HCV IRES is highly structured and greater than 50% of its nucleotides form based-paired helices. We report here that the HCV IRES is an activator of PKR, an interferon-induced enzyme that participates in host cell defense against viral infection. Binding of HCV IRES RNA to PKR leads to a greatly increased (20-fold) rate and level (4.5-fold) of PKR autophosphorylation compared to previously studied dsRNA activators. We have mapped the domains in the IRES required for PKR activation to domains III-IV and demonstrate that the N-terminal double-stranded RNA binding domains of PKR bind to the IRES in a similar manner to other RNA activators. Addition of HCV IRES RNA inhibits cap-dependent translation in lysates via phosphorylation of PKR and eIF2alpha. However, HCV IRES-mediated translation is not inhibited by the phosphorylation of PKR and eIF2alpha. The results presented here suggest that hydrolysis of GTP by eIF2 is not an essential step in IRES-mediated translation. Thus, HCV can use structured RNAs to its advantage in translation, while avoiding the deleterious effects of PKR activation.

    View details for DOI 10.1016/j.antiviral.2009.05.004

    View details for Web of Science ID 000269459300003

    View details for PubMedID 19467267

  • GTP Hydrolysis by IF2 Guides Progression of the Ribosome into Elongation MOLECULAR CELL Marshall, R. A., Aitken, C. E., Puglisi, J. D. 2009; 35 (1): 37-47

    Abstract

    Recent structural data have revealed two distinct conformations of the ribosome during initiation. We employed single-molecule fluorescence methods to probe the dynamic relation of these ribosomal conformations in real time. In the absence of initiation factors, the ribosome assembles in two distinct conformations. The initiation factors guide progression of the ribosome to the conformation that can enter the elongation cycle. In particular, IF2 both accelerates the rate of subunit joining and actively promotes the transition to the elongation-competent conformation. Blocking GTP hydrolysis by IF2 results in 70S complexes formed in the conformation unable to enter elongation. We observe that rapid GTP hydrolysis by IF2 drives the transition to the elongation-competent conformation, thus committing the ribosome to enter the elongation cycle.

    View details for DOI 10.1016/j.molcel.2009.06.008

    View details for PubMedID 19595714

  • THE DIVERSITY OF NUCLEAR MAGNETIC RESONANCE SPECTROSCOPY NATO Advanced Study Institute on Biophysics and the Challenges of Emerging Threats Liu, C. W., Alekseyev, V. Y., Allwardt, J. R., Bankovich, A. J., Cade-Menun, B. J., Davis, R. W., Du, L., Garcia, K. C., Herschlag, D., Khosla, C., Kraut, D. A., Li, Q., Null, B., Puglisi, J. D., Sigala, P. A., Stebbins, J. F., Varani, L. SPRINGER. 2009: 65–81
  • Single Molecule Studies of Prokaryotic Translation SINGLE MOLECULE BIOLOGY Aitken, C., Marshall, R., Dorywalska, M., Puglisi, J. D. edited by Knight, A. E. 2009: 195–222
  • IMPROVED DYE STABILITY IN SINGLE-MOLECULE FLUORESCENCE EXPERIMENTS NATO Advanced Study Institute on Biophysics and the Challenges of Emerging Threats Aitken, C. E., Marshall, R. A., Puglisi, J. D. SPRINGER. 2009: 83–99
  • Improved Dye Stability in Single-molecule Fluorescence Experiments NATO ASI Science Series, Springer Aitken CE, Marshall RA, Puglisi JD 2009; VIII: 83-99
  • Irreversible chemical steps control intersubunit dynamics during translation PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA Marshall, R. A., Dorywalska, M., Puglisi, J. D. 2008; 105 (40): 15364-15369

    Abstract

    The ribosome, a two-subunit macromolecular machine, deciphers the genetic code and catalyzes peptide bond formation. Dynamic rotational movement between ribosomal subunits is likely required for efficient and accurate protein synthesis, but direct observation of intersubunit dynamics has been obscured by the repetitive, multistep nature of translation. Here, we report a collection of single-molecule fluorescence resonance energy transfer assays that reveal a ribosomal intersubunit conformational cycle in real time during initiation and the first round of elongation. After subunit joining and delivery of correct aminoacyl-tRNA to the ribosome, peptide bond formation results in a rapid conformational change, consistent with the counterclockwise rotation of the 30S subunit with respect to the 50S subunit implied by prior structural and biochemical studies. Subsequent binding of elongation factor G and GTP hydrolysis results in a clockwise rotation of the 30S subunit relative to the 50S subunit, preparing the ribosome for the next round of tRNA selection and peptide bond formation. The ribosome thus harnesses the free energy of irreversible peptidyl transfer and GTP hydrolysis to surmount activation barriers to large-scale conformational changes during translation. Intersubunit rotation is likely a requirement for the concerted movement of tRNA and mRNA substrates during translocation.

    View details for DOI 10.1073/pnas.0805299105

    View details for PubMedID 18824686

  • NITAZOXANIDE (NTZ) IS AN INDUCER EIF2A AND PKR PHOSPHORYLATION 59th Annual Meeting of the American-Association-for-the-Study-of-Liver-Diseases Elazor, M., Liu, M., McKenna, S., Liu, P., Gehrig, E. A., Elfert, A., Puglisi, J., Rossignol, J., Glenn, J. S. WILEY-BLACKWELL. 2008: 1151A–1151A
  • Single-molecule imaging of full protein synthesis by immobilized ribosomes NUCLEIC ACIDS RESEARCH Uemura, S., Iizuka, R., Ueno, T., Shimizu, Y., Taguchi, H., Ueda, T., Puglisi, J. D., Funatsu, T. 2008; 36 (12)

    Abstract

    How folding of proteins is coupled to their synthesis remains poorly understood. Here, we apply single-molecule fluorescence imaging to full protein synthesis in vitro. Ribosomes were specifically immobilized onto glass surfaces and synthesis of green fluorescent protein (GFP) was achieved using modified commercial Protein Synthesis using Recombinant Elements that lacked ribosomes but contained purified factors and enzyme that are required for translation in Escherichia coli. Translation was monitored using a GFP mutant (F64L/S65T/F99S/M153T/V163A) that has a high fluorophore maturation rate and that contained the Secretion Monitor arrest sequence to prevent dissociation from the ribosome. Immobilized ribosomal subunits were labeled with Cy3 and GFP synthesis was measured by colocalization of GFP fluorescence with the ribosome position. The rate of appearance of colocalized ribosome GFP was equivalent to the rates of fluorescence appearance coupled with translation measured in bulk, and the ribosome-polypeptide complexes were stable for hours. The methods presented here are applicable to single-molecule investigation of translational initiation, elongation and cotranslational folding.

    View details for DOI 10.1093/nar/gkn338

    View details for Web of Science ID 000257578600035

    View details for PubMedID 18511463

    View details for PubMedCentralID PMC2475623

  • Nucleic acids and their protein partners CURRENT OPINION IN STRUCTURAL BIOLOGY Puglisi, J. D., Doudna, J. A. 2008; 18 (3): 279-281

    View details for DOI 10.1016/j.sbi.2008.05.004

    View details for Web of Science ID 000257539100001

    View details for PubMedID 18547801

  • An oxygen scavenging system for improvement of dye stability in single-molecule fluorescence experiments BIOPHYSICAL JOURNAL Aitken, C. E., Marshall, R. A., Puglisi, J. D. 2008; 94 (5): 1826-1835

    Abstract

    The application of single-molecule fluorescence techniques to complex biological systems places demands on the performance of single fluorophores. We present an enzymatic oxygen scavenging system for improved dye stability in single-molecule experiments. We compared the previously described protocatechuic acid/protocatechuate-3,4-dioxygenase system to the currently employed glucose oxidase/catalase system. Under standardized conditions, we observed lower dissolved oxygen concentrations with the protocatechuic acid/protocatechuate-3,4-dioxygenase system. Furthermore, we observed increased initial lifetimes of single Cy3, Cy5, and Alexa488 fluorophores. We further tested the effects of chemical additives in this system. We found that biological reducing agents increase both the frequency and duration of blinking events of Cy5, an effect that scales with reducing potential. We observed increased stability of Cy3 and Alexa488 in the presence of the antioxidants ascorbic acid and n-propyl gallate. This new O(2)-scavenging system should have wide application for single-molecule fluorescence experiments.

    View details for DOI 10.1529/biophysj.107.117689

    View details for PubMedID 17921203

  • Translation at the single-molecule level ANNUAL REVIEW OF BIOCHEMISTRY Marshall, R. A., Aitken, C. E., Dorywalska, M., Puglisi, J. D. 2008; 77: 177-203

    Abstract

    Decades of studies have established translation as a multistep, multicomponent process that requires intricate communication to achieve high levels of speed, accuracy, and regulation. A crucial next step in understanding translation is to reveal the functional significance of the large-scale motions implied by static ribosome structures. This requires determining the trajectories, timescales, forces, and biochemical signals that underlie these dynamic conformational changes. Single-molecule methods have emerged as important tools for the characterization of motion in complex systems, including translation. In this review, we chronicle the key discoveries in this nascent field, which have demonstrated the power and promise of single-molecule techniques in the study of translation.

    View details for DOI 10.1146/annurev.biochem.77.070606.101431

    View details for PubMedID 18518820

  • Structural biology - The dance of domains NATURE Puglisi, J. D. 2007; 450 (7173): 1171-1172

    View details for DOI 10.1038/4501171a

    View details for Web of Science ID 000251786200031

    View details for PubMedID 18097392

  • Thiostrepton inhibition of tRNA delivery to the ribosome RNA-A PUBLICATION OF THE RNA SOCIETY Gonzalez, R. L., Chu, S., Puglisi, J. D. 2007; 13 (12): 2091-2097

    Abstract

    Ribosome-stimulated hydrolysis of guanosine-5'-triphosphate (GTP) by guanosine triphosphatase (GTPase) translation factors drives protein synthesis by the ribosome. Allosteric coupling of GTP hydrolysis by elongation factor Tu (EF-Tu) at the ribosomal GTPase center to messenger RNA (mRNA) codon:aminoacyl-transfer RNA (aa-tRNA) anticodon recognition at the ribosomal decoding site is essential for accurate and rapid aa-tRNA selection. Here we use single-molecule methods to investigate the mechanism of action of the antibiotic thiostrepton and show that the GTPase center of the ribosome has at least two discrete functions during aa-tRNA selection: binding of EF-Tu(GTP) and stimulation of GTP hydrolysis by the factor. We separate these two functions of the GTPase center and assign each to distinct, conserved structural regions of the ribosome. The data provide a specific model for the coupling between the decoding site and the GTPase center during aa-tRNA selection as well as a general mechanistic model for ribosome-stimulated GTP hydrolysis by GTPase translation factors.

    View details for DOI 10.1261/rna.499407

    View details for PubMedID 17951333

  • PKR: A NMR perspective PROGRESS IN NUCLEAR MAGNETIC RESONANCE SPECTROSCOPY Lindhout, D. A., Mckenna, S. A., Aitken, C. E., Liu, C. W., Puglisi, J. D. 2007; 51 (3): 199-215
  • Probing the conformation of human tRNA(3)(Lys) in solution by NMR FEBS LETTERS Puglisi, E. V., Puglisi, J. D. 2007; 581 (27): 5307-5314

    Abstract

    Human tRNA(3)(Lys) acts as a primer for the reverse transcription of human immunodeficiency virus genomic RNA. To form an initiation complex with genomic RNA, tRNA(3)(Lys) must reorganize its secondary structure. To provide a starting point for mechanistic studies of the formation of the initiation complex, we here present solution NMR investigations of human tRNA(3)(Lys). We use a straightforward set of NMR experiments to show that tRNA(3)(Lys) adopts a standard transfer ribonucleic acid tertiary structure in solution, and that Mg(2+) is required for this folding. The results underscore the power of NMR to reveal rapidly the conformation of RNAs.

    View details for DOI 10.1016/j.febslet.2007.10.026

    View details for PubMedID 17963705

  • Fluctuations of transfer RNAs between classical and hybrid states BIOPHYSICAL JOURNAL Kim, H. D., Puglisi, J. D., Chu, S. 2007; 93 (10): 3575-3582

    Abstract

    Adjacent transfer RNAs (tRNAs) in the A- and P-sites of the ribosome are in dynamic equilibrium between two different conformations called classical and hybrid states before translocation. Here, we have used single-molecule fluorescence resonance energy transfer to study the effect of Mg(2+) on tRNA dynamics with and without an acetyl group on the A-site tRNA. When the A-site tRNA is not acetylated, tRNA dynamics do not depend on [Mg(2+)], indicating that the relative positions of the substrates for peptide-bond formation are not affected by Mg(2+). In sharp contrast, when the A-site tRNA is acetylated, Mg(2+) lengthens the lifetime of the classical state but does not change the lifetime of the hybrid state. Based on these findings, the classical state resembles a state with direct stabilization of tertiary structure by Mg(2+) ions whereas the hybrid state resembles a state with little Mg(2+)-assisted stabilization. The antibiotic viomycin, a translocation inhibitor, suppresses tRNA dynamics, suggesting that the enhanced fluctuations of tRNAs after peptide-bond formation drive spontaneous attempts at translocation by the ribosome.

    View details for DOI 10.1529/biophysj.107.109884

    View details for PubMedID 17693476

  • Solution structure and proposed domain-domain recognition interface of an acyl carrier protein domain from a modular polyketide synthase PROTEIN SCIENCE Alekseyev, V. Y., Liu, C. W., Cane, D. E., Puglisi, J. D., Khosla, C. 2007; 16 (10): 2093-2107

    Abstract

    Polyketides are a medicinally important class of natural products. The architecture of modular polyketide synthases (PKSs), composed of multiple covalently linked domains grouped into modules, provides an attractive framework for engineering novel polyketide-producing assemblies. However, impaired domain-domain interactions can compromise the efficiency of engineered polyketide biosynthesis. To facilitate the study of these domain-domain interactions, we have used nuclear magnetic resonance (NMR) spectroscopy to determine the first solution structure of an acyl carrier protein (ACP) domain from a modular PKS, 6-deoxyerythronolide B synthase (DEBS). The tertiary fold of this 10-kD domain is a three-helical bundle; an additional short helix in the second loop also contributes to the core helical packing. Superposition of residues 14-94 of the ensemble on the mean structure yields an average atomic RMSD of 0.64 +/- 0.09 Angstrom for the backbone atoms (1.21 +/- 0.13 Angstrom for all non-hydrogen atoms). The three major helices superimpose with a backbone RMSD of 0.48 +/- 0.10 Angstrom (0.99 +/- 0.11 Angstrom for non-hydrogen atoms). Based on this solution structure, homology models were constructed for five other DEBS ACP domains. Comparison of their steric and electrostatic surfaces at the putative interaction interface (centered on helix II) suggests a model for protein-protein recognition of ACP domains, consistent with the previously observed specificity. Site-directed mutagenesis experiments indicate that two of the identified residues influence the specificity of ACP recognition.

    View details for DOI 10.1110/ps.073011407

    View details for PubMedID 17893358

  • Viral dsRNA inhibitors prevent self-association and autophosphorylation of PKR JOURNAL OF MOLECULAR BIOLOGY Mckenna, S. A., Lindhout, D. A., Shimoike, T., Aitken, C. E., Puglisi, J. D. 2007; 372 (1): 103-113

    Abstract

    Host response to viral RNA genomes and replication products represents an effective strategy to combat viral invasion. PKR is a Ser/Thr protein kinase that binds to double-stranded (ds)RNA, autophosphorylates its kinase domain, and subsequently phosphorylates eukaryotic initiation factor 2alpha (eIF2alpha). This results in attenuation of protein translation, preventing synthesis of necessary viral proteins. In certain DNA viruses, PKR function can be evaded by transcription of highly structured virus-encoded dsRNA inhibitors that bind to and inactivate PKR. We probe here the mechanism of PKR inhibition by two viral inhibitor RNAs, EBER(I) (from Epstein-Barr) and VA(I) (from human adenovirus). Native gel shift mobility assays and isothermal titration calorimetry experiments confirmed that the RNA-binding domains of PKR are sufficient and necessary for the interaction with dsRNA inhibitors. Both EBER(I) and VA(I) are effective inhibitors of PKR activation by preventing trans-autophosphorylation between two PKR molecules. The RNA inhibitors prevent self-association of PKR molecules, providing a mechanistic basis for kinase inhibition. A variety of approaches indicated that dsRNA inhibitors remain associated with PKR under activating conditions, as opposed to activator dsRNA molecules that dissociate due to reduced affinity for the phosphorylated form of PKR. Finally, we show using a HeLa cell extract system that inhibitors of PKR result in translational recovery by the protein synthesis machinery. These data indicate that inhibitory dsRNAs bind preferentially to the latent, dephosphorylated form of PKR and prevent dimerization that is required for trans-autophosphorylation.

    View details for DOI 10.1016/j.jmb.2007.06.028

    View details for PubMedID 17619024

  • The role of fluctuations in tRNA selection by the ribosome PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA Lee, T., Blanchard, S. C., Kim, H. D., Puglisi, J. D., Chu, S. 2007; 104 (34): 13661-13665

    Abstract

    The detailed mechanism of how the ribosome decodes protein sequence information with an abnormally high accuracy, after 40 years of study, remains elusive. A critical element in selecting correct transfer RNA (tRNA) transferring correct amino acid is "induced fit" between the ribosome and tRNA. By using single-molecule methods, the induced fit mechanism is shown to position favorably the correct tRNA after initial codon recognition. We provide evidence that this difference in positioning and thermal fluctuations constitutes the primary mechanism for the initial selection of tRNA. This work demonstrates thermal fluctuations playing a critical role in the substrate selection by an enzyme.

    View details for DOI 10.1073/pnas.0705988104

    View details for PubMedID 17699629

  • Solution mapping of T cell receptor docking footprints on peptide-MHC PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA Varani, L., Bankovich, A. J., Liu, C. W., Colf, L. A., Jones, L. L., Kranz, D. M., Puglisi, J. D., Garcia, K. C. 2007; 104 (32): 13080-13085

    Abstract

    T cell receptor (TCR) recognition of peptide-MHC (pMHC) is central to the cellular immune response. A large database of TCR-pMHC structures is needed to reveal general structural principles, such as whether the repertoire of TCR/MHC docking modes is dictated by a "recognition code" between conserved elements of the TCR and MHC genes. Although approximately 17 cocrystal structures of unique TCR-pMHC complexes have been determined, cocrystallization of soluble TCR and pMHC remains a major technical obstacle in the field. Here we demonstrate a strategy, based on NMR chemical shift mapping, that permits rapid and reliable analysis of the solution footprint made by a TCR when binding onto the pMHC surface. We mapped the 2C TCR binding interaction with its allogeneic ligand H-2Ld-QL9 and identified a group of NMR-shifted residues that delineated a clear surface of the MHC that we defined as the TCR footprint. We subsequently found that the docking footprint described by NMR shifts was highly accurate compared with a recently determined high-resolution crystal structure of the same complex. The same NMR footprint analysis was done on a high-affinity mutant of the TCR. The current work serves as a foundation to explore the molecular dynamics of pMHC complexes and to rapidly determine the footprints of many Ld-specific TCRs.

    View details for DOI 10.1073/pnas.0703702104

    View details for PubMedID 17670943

  • Molecular framework for the activation of RNA-dependent protein kinase JOURNAL OF BIOLOGICAL CHEMISTRY Mckenna, S. A., Lindhout, D. A., Kim, I., Liu, C. W., Gelev, V. M., Wagner, G., Puglisi, J. D. 2007; 282 (15): 11474-11486

    Abstract

    The RNA-dependent protein kinase (PKR) plays an integral role in the antiviral response to cellular infection. PKR contains three distinct domains consisting of two conserved N-terminal double-stranded RNA (dsRNA)-binding domains, a C-terminal Ser-Thr kinase domain, and a central 80-residue linker. Despite rich structural and biochemical data, a detailed mechanistic explanation of PKR activation remains unclear. Here we provide a framework for understanding dsRNA-dependent activation of PKR using nuclear magnetic resonance spectroscopy, dynamic light scattering, gel filtration, and autophosphorylation kinetics. In the latent state, PKR exists as an extended monomer, with an increase in self-affinity upon dsRNA association. Subsequent phosphorylation leads to efficient release of dsRNA followed by a greater increase in self-affinity. Activated PKR displays extensive conformational perturbations within the kinase domain. We propose an updated model for PKR activation in which the communication between RNA binding, central linker, and kinase domains is critical in the propagation of the activation signal and for PKR dimerization.

    View details for DOI 10.1074/jbc.M700301200

    View details for PubMedID 17284445

  • Dynamics of translational regulation by PKR Puglisi, J. FEDERATION AMER SOC EXP BIOL. 2007: A45
  • Peptide bond formation destabilizes Shine-Dalgarno interaction on the ribosome NATURE Uemura, S., Dorywalska, M., Lee, T., Kim, H. D., Puglisi, J. D., Chu, S. 2007; 446 (7134): 454-457

    Abstract

    The ribosome is a molecular machine that translates the genetic code contained in the messenger RNA into an amino acid sequence through repetitive cycles of transfer RNA selection, peptide bond formation and translocation. Here we demonstrate an optical tweezer assay to measure the rupture force between a single ribosome complex and mRNA. The rupture force was compared between ribosome complexes assembled on an mRNA with and without a strong Shine-Dalgarno (SD) sequence-a sequence found just upstream of the coding region of bacterial mRNAs, involved in translation initiation. The removal of the SD sequence significantly reduced the rupture force in complexes carrying an aminoacyl tRNA, Phe-tRNA(Phe), in the A site, indicating that the SD interactions contribute significantly to the stability of the ribosomal complex on the mRNA before peptide bond formation. In contrast, the presence of a peptidyl tRNA analogue, N-acetyl-Phe-tRNA(Phe), in the A site, which mimicked the post-peptidyl transfer state, weakened the rupture force as compared to the complex with Phe-tRNA(Phe), and the resultant force was the same for both the SD-containing and SD-deficient mRNAs. These results suggest that formation of the first peptide bond destabilizes the SD interaction, resulting in the weakening of the force with which the ribosome grips an mRNA. This might be an important requirement to facilitate movement of the ribosome along mRNA during the first translocation step.

    View details for DOI 10.1038/nature05625

    View details for PubMedID 17377584

  • Rapid purification of RNAs using fast performance liquid chromatography (FPLC) RNA-A PUBLICATION OF THE RNA SOCIETY Kim, I., Mckenna, S. A., Puglisi, E. V., Puglisi, J. D. 2007; 13 (2): 289-294

    Abstract

    We present here an improved RNA purification method using fast performance liquid chromatography (FPLC) size-exclusion chromatography in place of denaturing polyacrylamide gel electrophoresis (PAGE). The method allows preparation of milligram quantities of pure RNA in a single day. As RNA oligonucleotides behave differently from globular proteins in the size-exclusion column, we present standard curves for RNA oligonucleotides of different lengths on both the Superdex 75 column and the Superdex 200 size-exclusion column. Using this approach, we can separate monomer from multimeric RNA species, purify the desired RNA product from hammerhead ribozyme reactions, and isolate refolded RNA that has aggregated after long-term storage. This methodology allows simple and rapid purification of RNA oligonucleotides for structural and biophysical studies.

    View details for DOI 10.1261/rna.342607

    View details for PubMedID 17179067

  • Peptide bond formation destabilizes Shine-Dalgarno interaction on the ribosome 51st Annual Meeting of the Biophysical-Society Uemura, S., Dorywalska, M., Lee, T., Kim, H. D., Puglisi, J. D., Chu, S. CELL PRESS. 2007: 571A–571A
  • Molecular insights into PKR activation by viral double-stranded RNA NATO Advanced Study Institute Course on Structure and Biophysics Mckenna, S. A., Lindhout, D. A., Aitken, C. E., Puglisi, J. D. SPRINGER. 2007: 99–110
  • Purification and characterization of transcribed RNAs using gel filtration chromatography NATURE PROTOCOLS Mckenna, S. A., Kim, I., Puglisi, E. V., Lindhout, D. A., Aitken, C. E., Marshall, R. A., Puglisi, J. D. 2007; 2 (12): 3270-3277

    Abstract

    RNA synthesis using in vitro transcription by phage T7 RNA polymerase allows preparation of milligram quantities of RNA for biochemical, biophysical and structural investigations. Previous purification approaches relied on gel electrophoretic or gravity-flow chromatography methods. We present here a protocol for the in vitro transcription of RNAs and subsequent purification using fast-performance liquid chromatography. This protocol greatly facilitates production of RNA in a single day from transcription to purification.

    View details for DOI 10.1038/nprot.2007.480

    View details for PubMedID 18079727

  • PKR: A NMR perspective JPNMRS Lindhout DA, McKenna SA, Aitken CE, Liu CW, Puglisi JD 2007; 51 (3): 199-215
  • NMR structural studies of aminoglycoside:RNA interaction Aminoglycoside Antibiotics, Edited by DP Arya, John Wiley & Sons Marshall RA, and Puglisi JD 2007: 181-207
  • Molecular Insights Into PKR Activation by Viral Double-Stranded RNA NATO Science Series, Springer McKenna SA, Lindhout DA, Aitken CE, Puglisi JD 2007; Ch 8: 99-110
  • Biophysical and biochemical investigations of dsRNA-activated kinase PKR TRANSLATION INITIATION: RECONSTITUTED SYSTEMS AND BIOPHYSICAL METHODS Mckenna, S. A., Lindhout, D. A., Shimoike, T., Puglisi, J. D. 2007; 430: 373-396

    Abstract

    Protein kinase RNA-activated (PKR) is a serine/threonine kinase that contains an N-terminal RNA-binding domain (dsRNA) and a C-terminal kinase domain. On binding viral dsRNA molecules, PKR can become activated and phosphorylate cellular targets, such as eukaryotic translation initiation factor 2alpha (eIF-2alpha). Phosphorylation of eIF-2alpha results in attenuation of protein translation initiation. Therefore, PKR plays an integral role in the antiviral response to cellular infection. Here we provide a methodological framework for probing PKR function by use of assays for phosphorylation, RNA-protein stability, PKR dimerization, and in vitro translation. These methods are complemented by nuclear magnetic resonance approaches for probing structural features of PKR activation. Considerations required for both PKR and dsRNA sample preparation are also discussed.

    View details for DOI 10.1016/S0076-6879(07)30014-1

    View details for PubMedID 17913645

  • PHYS 336-Role of dynamics in the initial selection of tRNA by the ribosome Lee, T., Blanchard, S. C., Kim, H. D., Puglisi, J. D., Chu, S. AMER CHEMICAL SOC. 2006
  • Uncoupling of RNA binding and PKR kinase activation by viral inhibitor RNAs JOURNAL OF MOLECULAR BIOLOGY Mckenna, S. A., Kim, I., Liu, C. W., Puglisi, J. D. 2006; 358 (5): 1270-1285

    Abstract

    Protein kinase RNA-activated (PKR) is a serine/threonine kinase that contains an N-terminal RNA-binding domain and a C-terminal kinase domain. Upon binding double-stranded RNA (dsRNA), PKR can become activated and phosphorylate cellular targets, such as eukaryotic translation initiation factor 2alpha (eIF-2alpha). Phosphorylation of eIF-2alpha results in attenuation of protein translation by the ribosome in either a general or an mRNA-specific manner. Therefore, the interaction between PKR and dsRNAs represents a crucial host cell defense mechanism against viral infection. Viruses can circumvent PKR function by transcription of virus-encoded dsRNA inhibitors that bind to and inactivate PKR. We present here a biophysical characterization of the interactions between human PKR and two viral inhibitor RNAs, EBER(I) (from Epstein-Barr virus) and VA(I) (from human adenovirus). Autophosphorylation assays confirmed that both EBER(I) and VA(I) are inhibitors of PKR activation, and profiled the kinetics of the inhibition. Binding affinities of dsRNAs to PKR double-stranded RNA-binding domains (dsRBDs) were determined by isothermal titration calorimetry and gel electrophoresis. A single stem-loop domain from each inhibitory RNA mediates the interaction with both dsRBDs of PKR. The binding sites on inhibitor RNAs and the dsRBDs of PKR have been mapped by NMR chemical shift perturbation experiments, which indicate that inhibitors of PKR employ similar surfaces of interaction as activators. Finally, we show that dsRNA binding and inactivation are non-equivalent; regions other than the dsRBD stem-loops of inhibitory RNA are required for inhibition.

    View details for DOI 10.1016/j.jmb.2006.03.003

    View details for PubMedID 16580685

  • Specific recognition of HIV TAR RNA by the dsRNA binding domains (dsRBD1-dsRBD2) of PKR JOURNAL OF MOLECULAR BIOLOGY Kim, I., Liu, C. W., Puglisi, J. D. 2006; 358 (2): 430-442

    Abstract

    PKR (double-stranded RNA-dependent protein kinase) is an important component of host defense to virus infection. Binding of dsRNA to two dsRBDs (double-stranded RNA binding domains) of PKR modulates its own kinase activation. How structural features of natural target RNAs, such as bulges and loops, have an effect on the binding to two dsRBDs of PKR still remains unclear. By using ITC and NMR, we show here that both the bulge and loop of TAR RNA are necessary for the high affinity binding to dsRBD1-dsRBD2 of PKR with 1:1 stoichiometry. The binding site for the dsRBD1-dsRBD2 spans from upper bulge to lower stem of the TAR RNA, based on chemical shift mapping. The backbone resonances in the 40 kDa TAR.dsRBD1-dsRBD2 were assigned. NMR chemical shift perturbation data suggest that the beta1-beta2 loop of the dsRBD1 interacts with the TAR RNA, whereas that of the dsRBD2 is less involved in the TAR RNA recognition. In addition, the residues of the interdomain linker between the dsRBD1 and the dsRBD2 also show large chemical perturbations indicating that the linker is involved in the recognition of TAR RNA. The results presented here provide the biophysical and spectroscopic basis for high-resolution structural studies, and show how local RNA structural features modulate recognition by dsRBDs.

    View details for DOI 10.1016/j.jmb.2006.01.099

    View details for PubMedID 16516925

  • Dynamics of translation Puglisi, J. D. FEDERATION AMER SOC EXP BIOL. 2006: A889
  • Quantitative polysome analysis identifies limitations in bacterial cell-free protein synthesis BIOTECHNOLOGY AND BIOENGINEERING Underwood, K. A., Swartz, J. R., Puglisi, J. D. 2005; 91 (4): 425-435

    Abstract

    Cell-free protein synthesis (CFPS) is becoming increasingly used for protein production as yields increase and costs decrease. CFPS optimization efforts have focused primarily on energy supply and small molecule metabolism, though little is known about the protein synthesis machinery or what limits protein synthesis rates. Here, quantitative polysome profile analysis was used to characterize cell-free translation, thereby elucidating many kinetic parameters. The ribosome concentration in Escherichia coli-based CFPS reactions was 1.6 +/- 0.1 microM, with 72 +/- 4% actively translating at maximal protein synthesis rate. A translation elongation rate of 1.5 +/- 0.2 amino acids per second per ribosome and an initiation rate of 8.2 x 10(-9) +/- 0.3 x 10(-9) M/s, which correlates to, on average, one initiation every 60 +/- 9 s per mRNA, were determined. The measured CFPS initiation and elongation rates are an order of magnitude lower than the in vivo rates and further analysis identified elongation as the major limitation. Adding purified elongation factors (EFs) to CFPS reactions increased the ribosome elongation rate and protein synthesis rates and yields, as well as the translation initiation rate, indicating a possible coupling between initiation and elongation. Further examination of translation initiation in the cell-free system showed that the first initiation on an mRNA is slower than subsequent initiations. Our results demonstrate that polysome analysis is a valid tool to characterize cell-free translation and to identify limiting steps, that dilution of translation factors is a limitation of CFPS, and that CFPS is a useful platform for making novel observations about translation.

    View details for DOI 10.1002/bit.20529

    View details for Web of Science ID 000230915400004

    View details for PubMedID 15991235

  • Structure determination of large biological RNAs NUCLEAR MAGNETIC RESONANCE OF BIOLOGICAL MACROMOLECULES, PART C Lukavsky, P. J., Puglisi, J. D. 2005; 394: 399-416

    Abstract

    Complex RNA structures regulate many biological processes but are often too large for structure determination by nuclear magnetic resonance (NMR) methods. We determined the solution structure of domain II of the hepatitis C viral internal ribosome entry site (HCV IRES), a 25-kDa RNA, using a novel NMR approach. Conventional short-range, distance, and torsion angle NMR restraints were combined with long-range, angular restraints derived from residual dipolar couplings (RDCs) to improve both the local and global precision of the structure. This powerful approach should be generally applicable to the NMR structure determination of large, modular RNAs.

    View details for Web of Science ID 000228718700016

    View details for PubMedID 15808230

  • Using NMR to Study large RNAs: Case Study of the HCV IRES NATO ASI Science Series, Ios Press Kim I, Lukavsky PJ, Otto GA, Liu CW, Puglisi JD 2005; 364: 75-90
  • Site-specific labeling of the ribosome for single-molecule spectroscopy NUCLEIC ACIDS RESEARCH Dorywalska, M., Blanchard, S. C., Gonzalez, R. L., Kim, H. D., Chu, S., Puglisi, J. D. 2005; 33 (1): 182-189

    Abstract

    Single-molecule fluorescence spectroscopy can reveal mechanistic and kinetic details that may not be observed in static structural and bulk biochemical studies of protein synthesis. One approach requires site-specific and stable attachment of fluorophores to the components of translation machinery. Fluorescent tagging of the ribosome is a prerequisite for the observation of dynamic changes in ribosomal conformation during translation using fluorescence methods. Modifications of the ribosomal particle are difficult due to its complexity and high degree of sequence and structural conservation. We have developed a general method to label specifically the prokaryotic ribosome by hybridization of fluorescent oligonucleotides to mutated ribosomal RNA. Functional, modified ribosomes can be purified as a homogenous population, and fluorescence can be monitored from labeled ribosomal complexes immobilized on a derivatized quartz surface.

    View details for DOI 10.1093/nar/gki151

    View details for PubMedID 15647501

  • The pathway of HCVIRES-mediated translation initiation CELL Otto, G. A., Puglisi, J. D. 2004; 119 (3): 369-380

    Abstract

    The HCV internal ribosome entry site (IRES) directly regulates the assembly of translation initiation complexes on viral mRNA by a sequential pathway that is distinct from canonical eukaryotic initiation. The HCV IRES can form a binary complex with an eIF-free 40S ribosomal subunit. Next, a 48S-like complex assembles at the AUG initiation codon upon association of eIF3 and ternary complex. 80S complex formation is rate limiting and follows the GTP-dependent association of the 60S subunit. Efficient assembly of the 48S-like and 80S complexes on the IRES mRNA is dependent upon maintenance of the highly conserved HCV IRES structure. This revised model of HCV IRES translation initiation provides a context to understand the function of different HCV IRES domains during translation initiation.

    View details for PubMedID 15507208

  • tRNA selection and kinetic proofreading in translation NATURE STRUCTURAL & MOLECULAR BIOLOGY Blanchard, S. C., Gonzalez, R. L., Kim, H. D., Chu, S., Puglisi, J. D. 2004; 11 (10): 1008-1014

    Abstract

    Using single-molecule methods we observed the stepwise movement of aminoacyl-tRNA (aa-tRNA) into the ribosome during selection and kinetic proofreading using single-molecule fluorescence resonance energy transfer (smFRET). Intermediate states in the pathway of tRNA delivery were observed using antibiotics and nonhydrolyzable GTP analogs. We identified three unambiguous FRET states corresponding to initial codon recognition, GTPase-activated and fully accommodated states. The antibiotic tetracycline blocks progression of aa-tRNA from the initial codon recognition state, whereas cleavage of the sarcin-ricin loop impedes progression from the GTPase-activated state. Our data support a model in which ribosomal recognition of correct codon-anticodon pairs drives rotational movement of the incoming complex of EF-Tu-GTP-aa-tRNA toward peptidyl-tRNA during selection on the ribosome. We propose a mechanistic model of initial selection and proofreading.

    View details for DOI 10.1038/nsmb831

    View details for PubMedID 15448679

  • tRNA dynamics on the ribosome during translation PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA Blanchard, S. C., Kim, H. D., Gonzalez, R. L., Puglisi, J. D., Chu, S. 2004; 101 (35): 12893-12898

    Abstract

    Using single-molecule fluorescence spectroscopy, time-resolved conformational changes between fluorescently labeled tRNA have been characterized within surface-immobilized ribosomes proceeding through a complete cycle of translation elongation. Fluorescence resonance energy transfer was used to observe aminoacyl-tRNA (aa-tRNA) stably accommodating into the aminoacyl site (A site) of the ribosome via a multistep, elongation factor-Tu dependent process. Subsequently, tRNA molecules, bound at the peptidyl site and A site, fluctuate between two configurations assigned as classical and hybrid states. The lifetime of classical and hybrid states, measured for complexes carrying aa-tRNA and peptidyl-tRNA at the A site, shows that peptide bond formation decreases the lifetime of the classical-state tRNA configuration by approximately 6-fold. These data suggest that the growing peptide chain plays a role in modulating fluctuations between hybrid and classical states. Single-molecule fluorescence resonance energy transfer was also used to observe aa-tRNA accommodation coupled with elongation factor G-mediated translocation. Dynamic rearrangements in tRNA configuration are also observed subsequent to the translocation reaction. This work underscores the importance of dynamics in ribosome function and demonstrates single-particle enzymology in a system of more than two components.

    View details for DOI 10.1073/pnas.0403884101

    View details for PubMedID 15317937

  • Large-scale preparation and purification of polyacrylamide-free RNA oligonucleotides RNA-A PUBLICATION OF THE RNA SOCIETY Lukavsky, P. J., Puglisi, J. D. 2004; 10 (5): 889-893

    Abstract

    We present a fast and simple protocol for large-scale preparation and purification of RNA oligonucleotides. RNA oligonucleotides are prepared by in vitro transcription with T7 RNA polymerase from linearized plasmid DNA templates constructed by PCR. In place of denaturing polyacrylamide gel electrophoresis (PAGE), size-exclusion chromatography is employed to purify the RNA oligonucleotide from the transcription mixture yielding >99% pure RNA product. In contrast to PAGE-based purification, the gel filtration method does not require denaturation of the RNA oligonucleotide, which is desirable for larger RNAs, and the product is free of low-molecular-weight acrylamide contaminants, which greatly benefits NMR, crystallographic, and other biophysical studies of large RNAs and RNA-protein complexes.

    View details for DOI 10.1261/rna.5264804

    View details for PubMedID 15100443

  • Design of a cyclic peptide that targets a viral RNA JOURNAL OF THE AMERICAN CHEMICAL SOCIETY Runyon, S. T., Puglisi, J. D. 2003; 125 (51): 15704-15705

    Abstract

    The Tat protein controls transcription in lentiviruses such as HIV. A cyclic peptide analog of the RNA binding domain of the bovine immunodeficiency virus (BIV) Tat protein is shown to bind specifically to its target RNA stem loop. NMR data indicate a similar mode of binding of linear and cyclic peptides.

    View details for DOI 10.1021/ja036344h

    View details for PubMedID 14677935

  • Thermodynamic stability and structural features of the J4/5 loop in a Pneumocystis carinii group I intron BIOCHEMISTRY Schroeder, S. J., Fountain, M. A., Kennedy, S. D., Lukavsky, P. J., Puglisi, J. D., Krugh, T. R., Turner, D. H. 2003; 42 (48): 14184-14196

    Abstract

    The J4/5 loop of the group I intron in the mouse-derived fungal pathogen Pneumocystis carinii is the docking site for the first step of the RNA-catalyzed self-splicing reaction and thus is a model of a potential drug target. This purine-rich asymmetric internal loop, 5'GGAAG/3'UAGU, is also thermodynamically more stable than other internal loops with two GU closing pairs and three nucleotides opposite two nucleotides. The results from optical melting, nuclear magnetic resonance spectroscopy, and functional group substitution experiments suggest that the GU closing pairs form and that sheared GA pairs form in the internal loop. The NMR spectra show evidence of conformational dynamics, and several GA pairings are possible. Thus, this dynamic loop presents several possible structures for potential binding of drugs that target group I self-splicing introns. The results also contribute to understanding the structural and dynamic basis for the function and thermodynamic stability of this loop.

    View details for DOI 10.1021/bi0301587

    View details for Web of Science ID 000186986700012

    View details for PubMedID 14640686

  • Structure of HCVIRES domain II determined by NMR NATURE STRUCTURAL BIOLOGY Lukavsky, P. J., Kim, I., Otto, G. A., Puglisi, J. D. 2003; 10 (12): 1033-1038

    Abstract

    Complex RNA structures regulate many biological processes, but are often too large for structure determination by NMR methods. The 5' untranslated region (5' UTR) of the hepatitis C viral (HCV) RNA genome contains an internal ribosome entry site (IRES) that binds to 40S ribosomal subunits with high affinity and specificity to control translation. Domain II of the HCV IRES forms a 25-kDa folded subdomain that may alter ribosome conformation. We report here the structure of domain II as determined using an NMR approach that combines short- and long-range structural data. Domain II adopts a distorted L-shape structure, and its overall shape in the free form is markedly similar to its 40S subunit-bound form; this suggests how domain II may modulate 40S subunit conformation. The results show how NMR can be used for structural analysis of large biological RNAs.

    View details for DOI 10.1038/nsb1004

    View details for PubMedID 14578934

  • Solution structure and backbone dynamics of the holo form of the frenolicin acyl carrier protein BIOCHEMISTRY Li, Q., Khosla, C., Puglisi, J. D., Liu, C. W. 2003; 42 (16): 4648-4657

    Abstract

    During polyketide biosynthesis, acyl carrier proteins (ACPs) perform the central role of transferring polyketide intermediates between active sites of polyketide synthase. The 4'-phosphopantetheine prosthetic group of a holo-ACP is a long and flexible arm that can reach into different active sites and provide a terminal sulfhydryl group for the attachment of acyl groups through a thioester linkage. We have determined the solution structure and characterized backbone dynamics of the holo form of the frenolicin acyl carrier protein (fren holo-ACP) by nuclear magnetic resonance (NMR). Unambiguous assignments were made for 433 hydrogen atoms, 333 carbon atoms, and 84 nitrogen atoms, representing a total of 94.6% of the assignable atoms in this protein. From 879 meaningful NOEs and 45 angle constraints, a family of 24 structures has been calculated. The solution structure is composed of three major alpha-helices packed in a bundle with three additional short helices in intervening loops; one of the short helices slowly exchanges between two conformations. Superposition of the major helical regions on the mean structure yields average atomic rmsd values of 0.49 +/- 0.09 and 0.91 +/- 0.08 A for backbone and non-hydrogen atoms, respectively. Although the three-helix bundle fold is conserved among acyl carrier proteins involved in fatty acid synthases and polyketide synthases, a detailed comparison revealed that ACPs from polyketide biosynthetic pathways are more related to each other in tertiary fold than to their homologues from fatty acid biosynthetic pathways. Comparison of the free form of ACPs (NMR structures of fren ACP and the Bacillus subtilis ACP) with the substrate-bound form of ACP (crystal structure of butyryl-ACP from Escherichia coli) suggests that conformational exchange plays a role in substrate binding.

    View details for DOI 10.1021/bi0274120

    View details for PubMedID 12705828

  • Comparison of x-ray crystal structure of the 30S subunit-antibiotic complex with NMR structure of decoding site oligonucleotide-paromomycin complex STRUCTURE Lynch, S. R., Gonzalez, R. L., Puglisi, J. D. 2003; 11 (1): 43-53

    Abstract

    Aminoglycoside antibiotics that bind to 16S ribosomal RNA in the aminoacyl-tRNA site (A site) cause misreading of the genetic code and inhibit translocation. Structures of an A site RNA oligonucleotide free in solution and bound to the aminoglycosides paromomycin or gentamicin C1a have been determined by NMR. Recently, the X-ray crystal structure of the entire 30S subunit has been determined, free and bound to paromomycin. Distinct differences were observed in the crystal structure, particularly at A1493. Here, the NMR structure of the oligonucleotide-paromomycin complex was determined with higher precision and is compared with the X-ray crystal structure of the 30S subunit complex. The comparison shows the validity of both structures in identifying critical interactions that affect ribosome function.

    View details for PubMedID 12517339

  • NMR study of 100 kDa HCV IRES RNA using segmental isotope labeling JOURNAL OF THE AMERICAN CHEMICAL SOCIETY Kim, I., Lukavsky, P. J., Puglisi, J. D. 2002; 124 (32): 9338-9339

    Abstract

    RNA NMR is hindered by the large size of most biological RNAs. We present here a simple method for segmental isotopic labeling of an RNA fragment within the context of a larger RNA. The methodology uses transcription and ribozyme cleavage to prepare appropriate ends for RNA ligase catalyzed ligation. We demonstrate that a 64 nucleotide domain of the Hepatitis C virus internal ribosome entry site (IRES) RNA adopts an independently folded domain within the context of the intact, 100 kDa IRES.

    View details for DOI 10.1021/ja026647w

    View details for PubMedID 12167005

  • Ribosomal proteins mediate the hepatitis C virus IRES-HeLa 40S interaction RNA-A PUBLICATION OF THE RNA SOCIETY Otto, G. A., Lukavsky, P. J., Lancaster, A. M., Sarnow, P., Puglisi, J. D. 2002; 8 (7): 913-923

    Abstract

    Translation of the hepatitis C virus genomic RNA is mediated by an internal ribosome entry site (IRES). The 330-nt IRES RNA forms a binary complex with the small 40S ribosomal subunit as a first step in translation initiation. Here chemical probing and 4-thiouridine-mediated crosslinking are used to characterize the interaction of the HCV IRES with the HeLa 40S subunit. No IRES-18S rRNA contacts were detected, but several specific crosslinks to 40S ribosomal proteins were observed. The identity of the crosslinked proteins agrees well with available structural information and provides new insights into HCV IRES function. The protein-rich surface of the 40S subunit thus mediates the IRES-ribosome interaction.

    View details for DOI 10.1017/S1355838202022057

    View details for PubMedID 12166646

  • Sequence-specific recognition of the major groove of RNA by deoxystreptamine BIOCHEMISTRY Yoshizawa, S., Fourmy, D., Eason, R. G., Puglisi, J. D. 2002; 41 (20): 6263-6270

    Abstract

    Aminoglycoside antibiotics specifically interact with a variety of RNA sequences, and in particular with the decoding region of 16S ribosomal RNA in the aminoacyl tRNA acceptor site (A-site). Ring II of aminoglycosides (2-deoxystreptamine) is the most conserved element among aminoglycoside antibiotics that bind to the A-site. NMR structures of aminoglycoside-A-site RNA complexes suggested that the 2-deoxystreptamine core of aminoglycosides specifically recognizes (5')G-U(3') and potentially (5')G-G(3') or (5')U-G(3') steps in the major groove of RNA. Here, we show that isolated deoxystreptamine specifically interacts with G-U steps within the major groove of the A-site RNA. The bulge residue of A-site RNA is required to open the major groove for accommodation of deoxystreptamine. The chemical groups of deoxystreptamine presented to the RNA by the framework of the 6-carbon ring modulate RNA recognition.

    View details for DOI 10.1021/bi0121609

    View details for PubMedID 12009887

  • RNAPack: An integrated NMR approach to RNA structure determination METHODS Lukavsky, P. J., Puglisi, J. D. 2001; 25 (3): 316-332

    Abstract

    Over the last decade, a vast number of useful nuclear magnetic resonance (NMR) experiments have been developed and successfully employed to determine the structure and dynamics of RNA oligonucleotides. Despite this progress, high-resolution RNA structure determination by NMR spectroscopy still remains a lengthy process and requires programming and extensive calibrations to perform NMR experiments successfully. To accelerate RNA structure determination by NMR spectroscopy, we have designed and programmed a package of RNA NMR experiments, called RNAPack. The user-friendly package contains a set of semiautomated single, double, and triple resonance NMR experiments, which are fully optimized for high-resolution RNA solution structure determination on Varian NMR spectrometers. RNAPack provides an autocalibration feature that allows rapid calibration of all NMR experiments in a single step and thereby speeds up the NMR data collection and eliminates user errors. In our laboratory, we have successfully employed this technology to solve RNA solution structures of domains of the internal ribosome entry site of the genomic hepatitis C viral RNA in less than 3 months. RNAPack therefore makes NMR spectroscopy an attractive and rapid structural tool and allows integration of atomic resolution structural information into biochemical studies of large RNA systems.

    View details for DOI 10.1006/meth.2001.1244

    View details for PubMedID 11860286

  • Aminoglycoside resistance with homogeneous and heterogeneous populations of antibiotic-resistant ribosomes ANTIMICROBIAL AGENTS AND CHEMOTHERAPY Recht, M. I., Puglisi, J. D. 2001; 45 (9): 2414-2419

    Abstract

    Aminoglycosides bind to rRNA in the small subunit of the bacterial ribosome. Mutations in the decoding region of 16S rRNA confer resistance to specific subsets of aminoglycoside antibiotics. The two major classes of 2-deoxystreptamine aminoglycosides are the 4,5- and the 4,6-disubstituted antibiotics. Antibiotics of the 4,5-disubstituted class include neomycin, paromomycin, and ribostamycin. Gentamicins and kanamycins belong to the 4,6-disubstituted class of aminoglycosides. Structural studies indicated the potential importance of position 1406 (Escherichia coli numbering) in the binding of ring III of the 4,6-disubstituted class of aminoglycosides to 16S rRNA. We have introduced a U1406-to-A mutation in a plasmid-encoded copy of E. coli 16S rRNA which has been expressed either in a mixture with wild-type ribosomes or in a strain in which all rRNA is transcribed from the plasmid-encoded rrn operon. High-level resistance to many of the 4,6-disubstituted aminoglycosides is observed only when all the rRNA contains the U1406-to-A mutation. In contrast to the partial dominance of resistance observed with other mutations in the decoding region, there is a dominance of sensitivity with the 1406A mutation. Chemical footprinting experiments indicate that resistance arises from a reduced affinity of the antibiotic for the rRNA target. These results demonstrate that although position 1406 is an important determinant in the binding and action of the 4,6-disubstituted aminoglycosides, other rRNA mutations that perturb the binding of ring I of both classes of 2-deoxystreptamine aminoglycosides confer higher levels of resistance as well as a partial dominance of resistance.

    View details for PubMedID 11502507

  • Solution structure of the A loop of 23S ribosomal RNA PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA Blanchard, S. C., Puglisi, J. D. 2001; 98 (7): 3720-3725

    Abstract

    The A loop is an essential RNA component of the ribosome peptidyltransferase center that directly interacts with aminoacyl (A)-site tRNA. The A loop is highly conserved and contains a ubiquitous 2'-O-methyl ribose modification at position U2552. Here, we present the solution structure of a modified and unmodified A-loop RNA to define both the A-loop fold and the structural impact of the U2552 modification. Solution data reveal that the A-loop RNA has a compact structure that includes a noncanonical base pair between C2556 and U2552. NMR evidence is presented that the N3 position of C2556 has a shifted pKa and that protonation at C2556-N3 changes the C-U pair geometry. Our data indicate that U2552 methylation modifies the A-loop fold, in particular the dynamics and position of residues C2556 and U2555. We compare our structural data with the structure of the A loop observed in a recent 50S crystal structure [Ban, N., Nissen, P., Hansen, J., Moore, P. B. & Steitz, T. A. (2000) Science 289, 905--920; Nissen, P., Hansen, J., Ban, N., Moore, P. B. & Steitz, T. A. (2000) Science 289, 920--930]. The solution and crystal structures of the A loop are dramatically different, suggesting that a structural rearrangement of the A loop must occur on docking into the peptidyltransferase center. Possible roles of this docking event, the shifted pKa of C2556 and the U2552 2'-O-methylation in the mechanism of translation, are discussed.

    View details for PubMedID 11259644

  • Structural origins of aminoglycoside specificity for prokaryotic ribosomes JOURNAL OF MOLECULAR BIOLOGY Lynch, S. R., Puglisi, J. D. 2001; 306 (5): 1037-1058

    Abstract

    Aminoglycoside antibiotics, including paromomycin, neomycin and gentamicin, target a region of highly conserved nucleotides in the decoding region aminoacyl-tRNA site (A site) of 16 S rRNA on the 30 S subunit. Change of a single nucleotide, A1408 to G, reduces the affinity of many aminoglycosides for the ribosome; G1408 distinguishes between prokaryotic and eukaryotic ribosomes. The structures of a prokaryotic decoding region A-site oligonucleotide free in solution and bound to the aminoglycosides paromomycin and gentamicin C1a were determined previously. Here, the structure of a eukaryotic decoding region A-site oligonucleotide bound to paromomycin has been determined using NMR spectroscopy and compared to the prokaryotic A-site-paromomycin structure. A conformational change in three adenosine residues of an internal loop, critical for high-affinity antibiotic binding, was observed in the prokaryotic RNA-paromomycin complex in comparison to its free form. This conformational change is not observed in the eukaryotic RNA-paromomycin complex, disrupting the binding pocket for ring I of the antibiotic. The lack of the conformational change supports footprinting and titration calorimetry data that demonstrate approximately 25-50-fold weaker binding of paromomycin to the eukaryotic decoding-site oligonucleotide. Neomycin, which is much less active against Escherichia coli ribosomes with an A1408G mutation, binds non-specifically to the oligonucleotide. These results suggest that eukaryotic ribosomal RNA has a shallow binding pocket for aminoglycosides, which accommodates only certain antibiotics.

    View details for PubMedID 11237617

  • Structure of a eukaryotic decoding region A-site RNA JOURNAL OF MOLECULAR BIOLOGY Lynch, S. R., Puglisi, J. D. 2001; 306 (5): 1023-1035

    Abstract

    The aminoglycoside antibiotics target a region of highly conserved nucleotides in the aminoacyl-tRNA site (A site) of 16 S RNA on the 30 S subunit. The structures of a prokaryotic decoding region A-site oligonucleotide free in solution and bound to the aminoglycosides paromomycin and gentamicin C1A have been determined. Here, the structure of a eukaryotic decoding region A-site oligonucleotide has been determined using homonuclear and heteronuclear NMR spectroscopy, and compared to the unbound prokaryotic rRNA structure. The two structures are similar, with a U1406-U1495 base-pair, a C1407-G1494 Watson-Crick base-pair, and a G1408-A1493 base-pair instead of the A1408-A1493 base-pair of the prokaryotic structure. The two structures differ in the orientation of the 1408 position with respect to A1493; G1408 is rotated toward the major groove, which is the binding pocket for aminoglycosides. The structures also differ in the stacking geometry of G1494 on A1493, which could have slight long-range conformational effects.

    View details for PubMedID 11237616

  • Molecular origins of ribosomal fidelity 4th NATO Advanced-Study-Institute on Dynamics, Structure and Function of Biological Macromolecules Puglisi, J. D., Yoshizawa, S., Fourmy, D. I O S PRESS. 2001: 177–185
  • Structural and functional investigation of the hepatitis C virus IRES. Nucleic acids research. Supplement (2001) Puglisi, J. D., Kim, I., Lukavsky, P., Otto, G., Lancaster, A., Sarnow, P. 2001: 263-?

    View details for PubMedID 12836365

  • Structures of two RNA domains essential for hepatitis C virus internal ribosome entry site function NATURE STRUCTURAL BIOLOGY Lukavsky, P. J., Otto, G. A., Lancaster, A. M., Sarnow, P., Puglisi, J. D. 2000; 7 (12): 1105-1110

    Abstract

    Translation of the hepatitis C virus (HCV) polyprotein is initiated at an internal ribosome entry site (IRES) element in the 5' untranslated region of HCV RNA. The HCV IRES element interacts directly with the 40S subunit, and biochemical experiments have implicated RNA elements near the AUG start codon as required for IRES-40S subunit complex formation. The data we present here show that two RNA stem loops, domains IIId and IIIe, are involved in IRES-40S subunit interaction. The structures of the two RNA domains were solved by NMR spectroscopy and reveal structural features that may explain their role in IRES function.

    View details for PubMedID 11101890

  • Approaching translation at atomic resolution NATURE STRUCTURAL BIOLOGY Puglisi, J. D., Blanchard, S. C., Green, R. 2000; 7 (10): 855-861

    Abstract

    Atomic resolution structures of 50S and 30S ribosomal particles have recently been solved by X-ray diffraction. These ribosomal structures show often unusual folds of ribosomal RNAs and proteins, and provide molecular explanations for fundamental aspects of translation. In the 50S structure, the active site for peptide bond formation was localized and found to consist of RNA. The ribosome is thus a ribozyme. In the 30S structures, tRNA binding sites were located, and molecular mechanisms for ribosomal fidelity were proposed. The 30S subunit particle has three globular domains, and relative movements of these domains may be required for translocation of the ribosome during protein synthesis. The structures are consistent with and rationalize decades of biochemical analysis of translation and usher in a molecular age in understanding the ribosome.

    View details for PubMedID 11017192

  • Application of residual dipolar coupling measurements to identify conformational changes in RNA induced by antibiotics JOURNAL OF THE AMERICAN CHEMICAL SOCIETY Lynch, S. R., Puglisi, J. D. 2000; 122 (32): 7853-7854
  • Interaction of translation initiation factor IF1 with the E-coli ribosomal A site JOURNAL OF MOLECULAR BIOLOGY Dahlquist, K. D., Puglisi, J. D. 2000; 299 (1): 1-15

    Abstract

    Initiation Factor 1 (IF1) is required for the initiation of translation in Escherichia coli. However, the precise function of IF1 remains unknown. Current evidence suggests that IF1 is an RNA-binding protein that sits in the A site of the decoding region of 16 S rRNA. IF1 binding to 30 S subunits changes the reactivity of nucleotides in the A site to chemical probes. The N1 position of A1408 is enhanced, while the N1 positions of A1492 and A1493 are protected from reactivity with dimethyl sulfate (DMS). The N1-N2 positions of G530 are also protected from reactivity with kethoxal. Quantitative footprinting experiments show that the dissociation constant for IF1 binding to the 30 S subunit is 0.9 microM and that IF1 also alters the reactivity of a subset of Class III sites that are protected by tRNA, 50 S subunits, or aminoglycoside antibiotics. IF1 enhances the reactivity of the N1 position of A1413, A908, and A909 to DMS and the N1-N2 positions of G1487 to kethoxal. To characterize this RNA-protein interaction, several ribosomal mutants in the decoding region RNA were created, and IF1 binding to wild-type and mutant 30 S subunits was monitored by chemical modification and primer extension with allele-specific primers. The mutations C1407U, A1408G, A1492G, or A1493G disrupt IF1 binding to 30 S subunits, whereas the mutations G530A, U1406A, U1406G, G1491U, U1495A, U1495C, or U1495G had little effect on IF1 binding. Disruption of IF1 binding correlates with the deleterious phenotypic effects of certain mutations. IF1 binding to the A site of the 30 S subunit may modulate subunit association and the fidelity of tRNA selection in the P site through conformational changes in the 16 S rRNA.

    View details for PubMedID 10860719

  • mRNA processing: The 3 '-end justifies the means NATURE STRUCTURAL BIOLOGY Puglisi, J. D. 2000; 7 (4): 263-264

    View details for Web of Science ID 000086256100003

    View details for PubMedID 10742163

  • Biochemical and nuclear magnetic resonance studies of aminoglycoside-RNA complexes RNA-LIGAND INTERACTIONS PT A Lynch, S. R., Recht, M. I., Puglisi, J. D. 2000; 317: 240-261

    View details for PubMedID 10829284

  • Application of Residual Dipolar Coupling Measurements to Identify Conformational Changes in RNA Induced by Antibiotics J. Am. Chem. Soc Lynch SR, and Puglisi JD 2000; 122: 7853-4
  • Aminoglycoside antibiotics and decoding International Ribosome Conference Puglisi, J. D., Blanchard, S. C., Dahlquist, K. D., Eason, R. G., Fourmy, D., Lynch, S. R., Recht, M. I., Yoshizawa, S. AMER SOC MICROBIOLOGY. 2000: 419–429
  • The ribosome revealed NATURE STRUCTURAL BIOLOGY Green, R., Puglisi, J. D. 1999; 6 (11): 999-1003

    Abstract

    Several recently reported structures reveal the details of ribosome architecture and provide new insights into the mechanism of protein synthesis.

    View details for Web of Science ID 000083377600006

    View details for PubMedID 10542087

  • Recognition of the codon-anticodon helix by ribosomal RNA SCIENCE Yoshizawa, S., Fourmy, D., Puglisi, J. D. 1999; 285 (5434): 1722-1725

    Abstract

    Translational fidelity is established by ribosomal recognition of the codon-anticodon interaction within the aminoacyl-transfer RNA (tRNA) site (A site) of the ribosome. Experiments are presented that reveal possible contacts between 16S ribosomal RNA and the codon-anticodon complex. N1 methylation of adenine at position 1492 (A1492) and A1493 interfered with A-site tRNA binding. Mutation of A1492 and A1493 to guanine or cytosine also impaired A-site tRNA binding. The deleterious effects of A1492G or A1493G (or both) mutations were compensated by 2'fluorine substitutions in the mRNA codon. The results suggest that the ribosome recognizes the codon-anticodon complex by adenine contacts to the messenger RNA backbone and provide a mechanism for molecular discrimination of correct versus incorrect codon-anticodon pairs.

    View details for PubMedID 10481006

  • Basis for prokaryotic specificity of action of aminoglycoside antibiotics EMBO JOURNAL Recht, M. I., Douthwaite, S., Puglisi, J. D. 1999; 18 (11): 3133-3138

    Abstract

    The aminoglycosides, a group of structurally related antibiotics, bind to rRNA in the small subunit of the prokaryotic ribosome. Most aminoglycosides are inactive or weakly active against eukaryotic ribosomes. A major difference in the binding site for these antibiotics between prokaryotic and eukaryotic ribosomes is the identity of the nucleotide at position 1408 (Escherichia coli numbering), which is an adenosine in prokaryotic ribosomes and a guanosine in eukaryotic ribosomes. Expression in E.coli of plasmid-encoded 16S rRNA containing an A1408 to G substitution confers resistance to a subclass of the aminoglycoside antibiotics that contain a 6' amino group on ring I. Chemical footprinting experiments indicate that resistance arises from the lower affinity of the drug for the eukaryotic rRNA sequence. The 1408G ribosomes are resistant to the same subclass of aminoglycosides as previously observed both for eukaryotic ribosomes and bacterial ribosomes containing a methylation at the N1 position of A1408. The results indicate that the identity of the nucleotide at position 1408 is a major determinant of specificity of aminoglycoside action, and agree with prior structural studies of aminoglycoside-rRNA complexes.

    View details for PubMedID 10357824

  • Structural origins for tibosome fidelity Puglisi, J. D. FEDERATION AMER SOC EXP BIOL. 1999: A1319
  • Effect of mutations in the A site of 16S rRNA on aminoglycoside antibiotic-ribosome interaction JOURNAL OF MOLECULAR BIOLOGY Recht, M. I., Douthwaite, S., Dahlquist, K. D., Puglisi, J. D. 1999; 286 (1): 33-43

    Abstract

    Decoding of genetic information occurs upon interaction of an mRNA codon-tRNA anticodon complex with the small subunit of the ribosome. The ribosomal decoding region is associated with highly conserved sequences near the 3' end of 16 S rRNA. The decoding process is perturbed by the aminoglycoside antibiotics, which also interact with this region of rRNA. Mutations of certain nucleotides in rRNA reduce aminoglycoside binding affinity, as previously demonstrated using a model RNA oligonucleotide system. Here, predictions from the oligonucleotide system were tested in the ribosome by mutation of universally conserved nucleotides at 1406 to 1408 and 1494 to 1495 in the decoding region of plasmid-encoded bacterial 16 S rRNA. Phenotypic changes range from the benign effect of U1406-->A or A1408-->G substitutions, to the highly deleterious 1406G and 1495 mutations that assemble into 30 S subunits but are defective in forming functional ribosomes. Changes in the local conformation of the decoding region caused by these mutations were identified by chemical probing of isolated 30 S subunits. Ribosomes containing 16 S rRNA with mutations at positions 1408, 1407+1494, or 1495 had reduced affinity for the aminoglycoside paromomycin, whereas no discernible reduction in affinity was observed with 1406 mutant ribosomes. These data are consistent with prior NMR structural determination of aminoglycoside interaction with the decoding region, and further our understanding of how aminoglycoside resistance can be conferred.

    View details for PubMedID 9931247

  • RNA Interaction with Small Ligands and Peptides The RNA World, 2nd Ed.: The Nature of Modern RNA Suggests a Prebiotic RNA World Puglisi JD, Williamson JR 1999; 37: 403-425
  • Structural basis for aminoglycoside antibiotic action Ribosomes 1999 Puglisi JD, Blanchard SC, Dahlquist KD, Eason RG, Fourmy D, Lynch SR, Recht MI, Yoshizawa S 1999; Ch 34: 419-29
  • HIV-1 A-rich RNA loop mimics the tRNA anticodon structure NATURE STRUCTURAL BIOLOGY Puglisi, E. V., Puglisi, J. D. 1998; 5 (12): 1033-1036

    Abstract

    Interaction of HIV-1 genomic RNA and human tRNA(Lys)3 initiates viral reverse transcription. An adenosine-rich (A-rich) loop in HIV RNA mediates complex formation between tRNA and viral RNA. We have determined the structure of an A-rich loop oligonucleotide using nuclear magnetic resonance spectroscopy. The loop structure is stabilized by a noncanonical G-A pair and a U-turn motif, which leads to stacking of the conserved adenosines. The structure has similarity to the tRNA anticodon structure, and suggests possible mechanisms for its role in initiation of reverse transcription.

    View details for PubMedID 9846871

  • Structural origins of gentamicin antibiotic action EMBO JOURNAL Yoshizawa, S., Fourmy, D., Puglisi, J. D. 1998; 17 (22): 6437-6448

    Abstract

    Aminoglycoside antibiotics that bind to the ribosomal A site cause misreading of the genetic code and inhibit translocation. The clinically important aminoglycoside, gentamicin C, is a mixture of three components. Binding of each gentamicin component to the ribosome and to a model RNA oligonucleotide was studied biochemically and the structure of the RNA complexed to gentamicin C1a was solved using magnetic resonance nuclear spectroscopy. Gentamicin C1a binds in the major groove of the RNA. Rings I and II of gentamicin direct specific RNA-drug interactions. Ring III of gentamicin, which distinguishes this subclass of aminoglycosides, also directs specific RNA interactions with conserved base pairs. The structure leads to a general model for specific ribosome recognition by aminoglycoside antibiotics and a possible mechanism for translational inhibition and miscoding. This study provides a structural rationale for chemical synthesis of novel aminoglycosides.

    View details for PubMedID 9822590

  • RRNA chemical groups required for aminoglycoside binding BIOCHEMISTRY Blanchard, S. C., Fourmy, D., Eason, R. G., Puglisi, J. D. 1998; 37 (21): 7716-7724

    Abstract

    Through an affinity chromatography based modification-interference assay, we have identified chemical groups within Escherichia coli 16S ribosomal RNA sequence that are required for binding the aminoglycoside antibiotic paromomycin. Paromomycin was covalently linked to solid support via a nine atom spacer from the 6"'-amine of ring IV, and chemical modifications to an A-site oligonucleotide that disrupted binding were identified. Positions in the RNA oligonucleotide that correspond to G1405(N7), G1491(N7), G1494(N7), A1408(N7), A1493(N7), A1408(N1), A1492(N1), and A1493(N1), as well as the pro-R phosphate oxygens of A1492 and A1493 in 16S rRNA are chemical groups that are essential for a high-affinity RNA-paromomycin interaction. These data are consistent with genetic, biochemical, and structural studies related to neomycin-class antibiotics and provide additional information for establishing an exact model for their interaction with the ribosome.

    View details for PubMedID 9601031

  • Binding of neomycin-class aminoglycoside antibiotics to the A-site of 16 S rRNA JOURNAL OF MOLECULAR BIOLOGY Fourmy, D., Recht, M. I., Puglisi, J. D. 1998; 277 (2): 347-362

    Abstract

    Aminoglycoside antibiotics that bind to ribosomal RNA in the aminoacyl-tRNA site (A-site) cause misreading of the genetic code and inhibit translocation. We have recently solved the structure of an A-site RNA-paromomycin complex. The structure suggested that rings I and II, common to all aminoglycosides that bind to the A-site, are the minimum motif for specific ribosome binding to affect translation. This hypothesis was tested biochemically and with a detailed comparative NMR study of interaction of the aminoglycosides paromomycin, neomycin, ribostamycin, and neamine with the A-site RNA. Our NMR data show that rings I and II of neomycin-class aminoglycosides are sufficient to confer specificity to the binding of the antibiotics to the model A-site RNA. Neomycin, paromomycin, ribostamycin and neamine bind in the major groove of the A-site RNA in a unique binding pocket formed by non-canonical base pairs and a bulged nucleotide. Similar NMR properties of the RNA and the diverse antibiotics within the different complexes formed with neomycin, paromomycin, ribostamycin and neamine suggest similar structures for these complexes.

    View details for Web of Science ID 000073192600016

    View details for PubMedID 9514735

  • Paromomycin binding induces a local conformational change in the A-site of 16 S rRNA JOURNAL OF MOLECULAR BIOLOGY Fourmy, D., Yoshizawa, S., Puglisi, J. D. 1998; 277 (2): 333-345

    Abstract

    Aminoglycoside antibiotics that bind to ribosomal RNA in the aminoacyl-tRNA site (A-site) cause misreading of the genetic code and inhibit translocation. An A-site RNA oligonucleotide specifically binds to aminoglycoside antibiotics and the structure of the RNA-paromomycin complex was previously determined by nuclear magnetic resonance (NMR) spectroscopy. Here, the A-site RNA structure in its free form has been determined using heteronuclear NMR and compared to the structure of the paromomycin-RNA complex. As in the complex with paromomycin, the asymmetric internal loop is closed by a Watson-Crick base-pair (C1407.G1494) and by two non-canonical base-pairs (U1406.U1495, A1408.A1493). A1492 stacks below A1493 and is intercalated between the upper and lower stems. The comparison of the free and bound conformations of the RNA shows that two universally conserved residues of the A site of 16 S rRNA, A1492 and A1493, are displaced towards the minor groove of the RNA helix in presence of antibiotic. These changes in the RNA conformation place the N1 positions of A1492 and A1493 on the minor groove side of the A-site RNA and suggest a mechanism of action of aminoglycosides on translation.

    View details for Web of Science ID 000073192600015

    View details for PubMedID 9514734

  • NMR structure determination of an antibiotic-RNA complex NATO Advanced Study Institute and International School of Structural Biology and Magnetic Resonance, 3rd Course on Protein Dynamics. Function, and Design Yoshizawa, S., Puglisi, J. D. PLENUM PRESS DIV PLENUM PUBLISHING CORP. 1998: 173–182
  • NMR structure determination of an antibiotic-RNA complex NATO ASI Series Yoshisawa S, and Puglisi JD 1998; 301: 173-82
  • Nuclear magnetic resonance spectroscopy of RNA CSHL Press (In RNA Structure and Function, (Symons, R. W., and Grunberg-Manago, M., eds). Puglisi EV, and Puglisi JD 1998: 117-46
  • Structure of a conserved RNA component of the peptidyl transferase centre NATURE STRUCTURAL BIOLOGY Puglisi, E. V., Green, R., Noller, H. F., Puglisi, J. D. 1997; 4 (10): 775-778

    Abstract

    The structure of a conserved hairpin loop involved in peptidyl-tRNA recognition by 50S ribosomal subunits has been solved by NMR. The loop is closed by a novel G-C base pair and presents guanine residues for RNA recognition.

    View details for Web of Science ID A1997YA20300005

    View details for PubMedID 9334738

  • Structural basis for aminoglycoside antibiotic action Many Faces of RNA Puglisi JD 1997: 97-111
  • Structure of the A site of Escherichia coli 16S ribosomal RNA complexed with an aminoglycoside antibiotic SCIENCE Fourmy, D., Recht, M. I., Blanchard, S. C., Puglisi, J. D. 1996; 274 (5291): 1367-1371

    Abstract

    Aminoglycoside antibiotics that bind to 30S ribosomal A-site RNA cause misreading of the genetic code and inhibit translocation. The aminoglycoside antibiotic paromomycin binds specifically to an RNA oligonucleotide that contains the 30S subunit A site, and the solution structure of the RNA-paromomycin complex was determined by nuclear magnetic resonance spectroscopy. The antibiotic binds in the major groove of the model A-site RNA within a pocket created by an A-A base pair and a single bulged adenine. Specific interactions occur between aminoglycoside chemical groups important for antibiotic activity and conserved nucleotides in the RNA. The structure explains binding of diverse aminoglycosides to the ribosome, their specific activity against prokaryotic organisms, and various resistance mechanisms, and provides insight into ribosome function.

    View details for Web of Science ID A1996VU95400051

    View details for PubMedID 8910275

  • RNA sequence determinants for aminoglycoside binding to an A-site rRNA model oligonucleotide JOURNAL OF MOLECULAR BIOLOGY Recht, M. I., Fourmy, D., Blanchard, S. C., Dahlquist, K. D., Puglisi, J. D. 1996; 262 (4): 421-436

    Abstract

    The codon-anticodon interaction on the ribosome occurs in the A site of the 30 S subunit. Aminoglycoside antibiotics, which bind to ribosomal RNA in the A site, cause misreading of the genetic code and inhibit translocation. Biochemical studies and nuclear magnetic resonance spectroscopy were used to characterize the interaction between the aminoglycoside antibiotic paromomycin and a small model oligonucleotide that mimics the A site of Escherichia coli 16 S ribosomal RNA. Upon chemical modification, the RNA oligonucleotide exhibits an accessibility pattern similar to that of 16 S rRNA in the 30 S subunit. In addition, the oligonucleotide binds specifically aminoglycoside antibiotics. The antibiotic binding site forms an asymmetric internal loop, caused by non-canonical base-pairs. Nucleotides that are important for binding of paromomycin were identified by performing quantitative footprinting on oligonucleotide sequence variants and include the C1407.G1494 base-pair, and A.U base-pair at positions 1410/1490, and nucleotides A1408, A1493 and U1495. The asymmetry of the internal loop, which requires the presence of a nucleotide in position 1492, is also crucial for antibiotic binding. Introduction into the oligonucleotide of base changes that are known to confer aminoglycoside resistance in 16 S rRNA result in weaker binding of paromomycin to the oligonucleotide. Oligonucleotides homologous to eukaryotic rRNA sequences show reduced binding of paromomycin, suggesting a physical origin for the species-specific action of aminoglycosides.

    View details for Web of Science ID A1996VK74900005

    View details for PubMedID 8893854

  • SOLUTION STRUCTURE OF A BOVINE IMMUNODEFICIENCY VIRUS TAT-TAR PEPTIDE-RNA COMPLEX SCIENCE Puglisi, J. D., Chen, L., Blanchard, S., Frankel, A. D. 1995; 270 (5239): 1200-1203

    Abstract

    The Tat protein of bovine immunodeficiency virus (BIV) binds to its target RNA, TAR, and activates transcription. A 14-amino acid arginine-rich peptide corresponding to the RNA-binding domain of BIV Tat binds specifically to BIV TAR, and biochemical and in vivo experiments have identified the amino acids and nucleotides required for binding. The solution structure of the RNA-peptide complex has now been determined by nuclear magnetic resonance spectroscopy. TAR forms a virtually continuous A-form helix with two unstacked bulged nucleotides. The peptide adopts a beta-turn conformation and sits in the major groove of the RNA. Specific contacts are apparent between critical amino acids in the peptide and bases and phosphates in the RNA. The structure is consistent with all biochemical data and demonstrates ways in which proteins can recognize the major groove of RNA.

    View details for Web of Science ID A1995TE90500057

    View details for PubMedID 7502045

  • Biochemical and NMR studies of RNA conformation with an emphasis on RNA pseudoknots NUCLEAR MAGNETIC RESONANCE AND NUCLEIC ACIDS Puglisi, J. D., Wyatt, J. R. 1995; 261: 323-350

    View details for Web of Science ID A1995BE40N00014

    View details for PubMedID 8569502

  • Welcome guests to the RNA World: Proteins that interact with RNA Chemistry and Biology Puglisi JD 1995; 2: 581
  • Investigating the structure and function of translation initiation factor 1 in Escherichia coli. Nucleic acids symposium series Dahlquist, K., Puglisi, J. D. 1995: 170-171

    View details for PubMedID 8643361

  • NMR ANALYSIS OF TRANSFER-RNA ACCEPTOR STEM MICROHELICES - DISCRIMINATOR BASE CHANGE AFFECTS TRANSFER-RNA CONFORMATION AT THE 3' END PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA Puglisi, E. V., Puglisi, J. D., Williamson, J. R., RajBhandary, U. L. 1994; 91 (24): 11467-11471

    Abstract

    An important step in initiation of protein synthesis in Escherichia coli is the specific formylation of the initiator methionyl-tRNA (Met-tRNA) by Met-tRNA transformylase. The determinants for formylation are clustered mostly in the acceptor stem of the initiator tRNA. Here we use NMR spectroscopy to characterize the conformation of two RNA microhelices, which correspond to the acceptor stem of mutants of E. coli initiator tRNA and which differ only at the position corresponding to the "discriminator base" in tRNAs. One of the mutant tRNAs is an extremely poor substrate for Met-tRNA transformylase, whereas the other one is a much better substrate. We show that one microhelix forms a structure in which its 3'-ACCA sequence extends the stacking of the acceptor stem. The other microhelix forms a structure in which its 3'-UCCA sequence folds back such that the 3'-terminal A22 is in close proximity to G1. These results highlight the importance of the discriminator base in determining tRNA conformation at the 3' end. They also suggest a correlation between tRNA structure at the 3' end and its recognition by Met-tRNA transformylase.

    View details for Web of Science ID A1994PU28500038

    View details for PubMedID 7972085

  • NMR-STUDIES OF HIV TAR RNA 8th Conversation in the Discipline Biomolecular Stereodynamics Puglisi, J. D., Williamson, J. R. ADENINE PRESS. 1994: 285–291
  • ADDITIVE, COOPERATIVE AND ANTI-COOPERATIVE EFFECTS BETWEEN IDENTITY NUCLEOTIDES OF A TRANSFER-RNA EMBO JOURNAL Putz, J., Puglisi, J. D., Florentz, C., Giege, R. 1993; 12 (7): 2949-2957

    Abstract

    We have investigated the functional relationship between nucleotides in yeast tRNAAsp that are important for aspartylation by yeast aspartyl-tRNA synthetase. Transcripts of tRNAAsp with two or more mutations at identity positions G73, G34, U35, C36 and base pair G10-U25 have been prepared and the steady-state kinetics of their aspartylation were measured. Multiple mutations affect the catalytic activities of the synthetase mainly at the level of the catalytic constant, kcat. Kinetic data were expressed as free energy variation at transition state of these multiple mutants and comparison of experimental values with those calculated from results on single mutants defined three types of relationships between the identity nucleotides of this tRNA. Nucleotides located far apart in the three-dimensional structure of the tRNA act cooperatively whereas nucleotides of the anticodon triplet act either additively or anti-cooperatively. These results are related to the specific interactions of functional groups on identity nucleotides with amino acids in the protein as revealed by the crystal structure of the tRNAAsp/aspartyl-tRNA synthetase complex. These relationships between identity nucleotides may play an important role in the biological function of tRNAs.

    View details for Web of Science ID A1993LK36400040

    View details for PubMedID 8335008

  • ROLE OF RNA STRUCTURE IN ARGININE RECOGNITION OF TAR RNA PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA Puglisi, J. D., Chen, L., Frankel, A. D., Williamson, J. R. 1993; 90 (8): 3680-3684

    Abstract

    The human immunodeficiency virus Tat protein binds specifically to an RNA stem-loop structure (TAR) that contains two helical stem regions separated by a three-nucleotide bulge. A single arginine within the basic region of Tat mediates specific binding to TAR, and arginine as the free amino acid also binds specifically to TAR. We have previously proposed a model in which interaction of the arginine guanidinium group with guanosine-26 (G26) and with a pair of phosphates is stabilized by formation of a base triple between U23 in the bulge and A27.U38 in the upper helix. Here we show by NMR spectroscopy that formation of the base triple is critical for arginine binding to TAR. Mutants of TAR that cannot form the base triple or that remove the guanine contact do not bind arginine specifically. These mutants also showed reduced transactivation by Tat. A triple mutant designed to form an isomorphous base triple between C23 and G27.C38 binds arginine and adopts the same conformation as wild-type TAR. These results demonstrate the importance of RNA structure for arginine binding and further demonstrate the direct correspondence between arginine and Tat binding.

    View details for Web of Science ID A1993KX81600117

    View details for PubMedID 7682716

  • INFLUENCE OF TRANSFER-RNA TERTIARY STRUCTURE AND STABILITY ON AMINOACYLATION BY YEAST ASPARTYL-TRANSFER RNA-SYNTHETASE NUCLEIC ACIDS RESEARCH Puglisi, J. D., Putz, J., Florentz, C., Giege, R. 1993; 21 (1): 41-49

    Abstract

    Mutations have been designed that disrupt the tertiary structure of yeast tRNA(Asp). The effects of these mutations on both tRNA structure and specific aspartylation by yeast aspartyl-tRNA synthetase were assayed. Mutations that disrupt tertiary interactions involving the D-stem or D-loop result in destabilization of the base-pairing in the D-stem, as monitored by nuclease digestion and chemical modification studies. These mutations also decrease the specificity constant (kcat/Km) for aspartylation by aspartyl-tRNA synthetase up to 10(3)-10(4) fold. The size of the T-loop also influences tRNA(Asp) structure and function; change of its T-loop to a tetraloop (-UUCG-) sequence results in a denatured D-stem and an almost 10(4) fold decrease of kcat/Km for aspartylation. The negative effects of these mutations on aspartylation activity are significantly alleviated by additional mutations that stabilize the D-stem. These results indicate that a critical role of tertiary structure in tRNA(Asp) for aspartylation is the maintenance of a base-paired D-stem.

    View details for Web of Science ID A1993KJ06900007

    View details for PubMedID 8441619

  • TRANSFER-RNA STRUCTURE AND AMINOACYLATION EFFICIENCY PROGRESS IN NUCLEIC ACID RESEARCH AND MOLECULAR BIOLOGY, VOL 45 Giege, R., Puglisi, J. D., Florentz, C. 1993; 45: 129-206

    View details for Web of Science ID A1993BZ69L00006

    View details for PubMedID 8341800

  • PREPARATION OF ISOTOPICALLY LABELED RIBONUCLEOTIDES FOR MULTIDIMENSIONAL NMR-SPECTROSCOPY OF RNA NUCLEIC ACIDS RESEARCH Batey, R. T., Inada, M., Kujawinski, E., Puglisi, J. D., Williamson, J. R. 1992; 20 (17): 4515-4523

    Abstract

    A general method for large scale preparation of uniformly isotopically labeled ribonucleotides and RNAs is described. Bacteria are grown on isotopic growth medium, and their nucleic acids are harvested and degraded to mononucleotides. These are enzymatically converted into ribonucleoside triphosphates, which are used in transcription reactions in vitro to prepare RNAs for NMR studies. For 15N-labeling, E.coli is grown on 15N-ammonium sulfate, whereas for 13C-labeling, Methylophilus methylotrophus is grown on 13C-methanol, which is more economical than 13C-glucose. To demonstrate the feasibility and utility of this method, uniformly 13C-labeled ribonucleotides were used to synthesize a 31 nucleotide HIV TAR RNA that was analyzed by 3D-NMR. This method should find widespread use in the structural analysis of RNA by NMR.

    View details for Web of Science ID A1992JP42300017

    View details for PubMedID 1383928

  • EFFECT OF CONFORMATIONAL FEATURES ON THE AMINOACYLATION OF TRANSFER-RNAS AND CONSEQUENCES ON THE PERMUTATION OF TRANSFER-RNA SPECIFICITIES JOURNAL OF MOLECULAR BIOLOGY Perret, V., Florentz, C., Puglisi, J. D., Giege, R. 1992; 226 (2): 323-333

    Abstract

    The structure and function of in vitro transcribed tRNA(Asp) variants with inserted conformational features characteristic of yeast tRNA(Phe), such as the length of the variable region or the arrangement of the conserved residues in the D-loop, have been investigated. Although they exhibit significant conformational alterations as revealed by Pb2+ treatment, these variants are still efficiently aspartylated by yeast aspartyl-tRNA synthetase. Thus, this synthetase can accommodate a variety of tRNA conformers. In a second series of variants, the identity determinants of yeast tRNA(Phe) were transplanted into the previous structural variants of tRNA(Asp). The phenylalanine acceptance of these variants improves with increasing the number of structural characteristics of tRNA(Phe), suggesting that phenylalanyl-tRNA synthetase is sensitive to the conformational frame embedding the cognate identity nucleotides. These results contrast with the efficient transplantation of tRNA(Asp) identity elements into yeast tRNA(Phe). This indicates that synthetases respond differently to the detailed conformation of their tRNA substrates. Efficient aminoacylation is not only dependent on the presence of the set of identity nucleotides, but also on a precise conformation of the tRNA.

    View details for Web of Science ID A1992JF96600006

    View details for PubMedID 1640453

  • CONFORMATION OF THE TAR RNA-ARGININE COMPLEX BY NMR-SPECTROSCOPY SCIENCE Puglisi, J. D., Tan, R. Y., CALNAN, B. J., Frankel, A. D., Williamson, J. R. 1992; 257 (5066): 76-80

    Abstract

    The messenger RNAs of human immunodeficiency virus-1 (HIV-1) have an RNA hairpin structure, TAR, at their 5' ends that contains a six-nucleotide loop and a three-nucleotide bulge. The conformations of TAR RNA and of TAR with an arginine analog specifically bound at the binding site for the viral protein, Tat, were characterized by nuclear magnetic resonance (NMR) spectroscopy. Upon arginine binding, the bulge changes conformation, and essential nucleotides for binding, U23 and A27.U38, form a base-triple interaction that stabilizes arginine hydrogen bonding to G26 and phosphates. Specificity in the arginine-TAR interaction appears to be derived largely from the structure of the RNA.

    View details for Web of Science ID A1992JC16500033

    View details for PubMedID 1621097

  • DETERMINANT NUCLEOTIDES OF YEAST TRANSFER RNA(ASP) INTERACT DIRECTLY WITH ASPARTYL-TRANSFER RNA-SYNTHETASE PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA Rudinger, J., Puglisi, J. D., Putz, J., Schatz, D., Eckstein, F., Florentz, C., Giege, R. 1992; 89 (13): 5882-5886

    Abstract

    The interaction of wild-type and mutant yeast tRNA(Asp) transcripts with yeast aspartyl-tRNA synthetase (AspRS; EC 6.1.1.12) has been probed by using iodine cleavage of phosphorothioate-substituted transcripts. AspRS protects phosphates in the anticodon (G34, U35), D-stem (U25), and acceptor end (G73) that correspond to determinant nucleotides for aspartylation. This protection, as well as that in anticodon stem (C29, U40, G41) and D-stem (U11 to U13), is consistent with direct interaction of AspRS at these phosphates. Other protection, in the variable loop (G45), D-loop (G18, G19), and T-stem and loop (G53, U54, U55), as well as enhanced reactivity at G37, may result from conformational changes of the transcript upon binding to AspRS. Transcripts mutated at determinant positions showed a loss of phosphate protection in the region of the mutation while maintaining the global protection pattern. The ensemble of results suggests that aspartylation specificity arises from both protein-base and protein-phosphate contacts and that different regions of tRNA(Asp) interact independently with AspRS. A mutant transcript of yeast tRNA(Phe) that contains the set of identity nucleotides for specific aspartylation gave a phosphate protection pattern strikingly similar to that of wild-type tRNA(Asp). This confirms that a small number of nucleotides within a different tRNA sequence context can direct specific interaction with synthetase.

    View details for Web of Science ID A1992JC86800038

    View details for PubMedID 1631068

  • Structure and Function of HIV TAR RNA Advances in Life Sciences, (In Structural Tools for the Analysis of Protein-Nucleic Acid Complexes, D Lilley, H Heumann, D Suck, ed.). Puglisi JD, Tan R, Frankel AD, Williamson JR 1992: 269-85
  • SYNTHESIS AND PURIFICATION OF LARGE AMOUNTS OF RNA OLIGONUCLEOTIDES BIOTECHNIQUES Wyatt, J. R., Chastain, M., Puglisi, J. D. 1991; 11 (6): 764-769

    Abstract

    Biophysical studies of RNA oligonucleotides require milligram amounts of RNA of specific length and sequence. Transcription from synthetic DNA templates using T7 RNA polymerase is a convenient method for synthesis of RNA oligonucleotides ranging in size from 9 to about 45 nucleotides. Here we present methods that make the large-scale synthesis of RNA oligonucleotides practical. This paper describes a rapid method for isolating T7 RNA polymerase free from RNases for use in transcription reactions. Protocols are also described for purification of the desired RNA oligonucleotide from the other products of transcription.

    View details for Web of Science ID A1991GU03100018

    View details for PubMedID 1809333

  • IDENTITY ELEMENTS FOR SPECIFIC AMINOACYLATION OF YEAST TRANSFER RNAASP BY COGNATE ASPARTYL-TRANSFER RNA-SYNTHETASE SCIENCE Putz, J., Puglisi, J. D., Florentz, C., Giege, R. 1991; 252 (5013): 1696-1699

    Abstract

    The nucleotides crucial for the specific aminoacylation of yeast tRNA(Asp) by its cognate synthetase have been identified. Steady-state aminoacylation kinetics of unmodified tRNA transcripts indicate that G34, U35, C36, and G73 are important determinants of tRNA(Asp) identity. Mutations at these positions result in a large decrease (19- to 530-fold) of the kinetic specificity constant (ratio of the catalytic rate constant kcat and the Michaelis constant Km) for aspartylation relative to wild-type tRNA(Asp). Mutation to G10-C25 within the D-stem reduced kcat/Km eightfold. This fifth mutation probably indirectly affects the presentation of the highly conserved G10 nucleotide to the synthetase. A yeast tRNA(Phe) was converted into an efficient substrate for aspartyl-tRNA synthetase through introduction of the five identity elements. The identity nucleotides are located in regions of tight interaction between tRNA and synthetase as shown in the crystal structure of the complex and suggest sites of base-specific contacts.

    View details for Web of Science ID A1991FT11400043

    View details for PubMedID 2047878

  • RNA PSEUDOKNOTS ACCOUNTS OF CHEMICAL RESEARCH Puglisi, J. D., Wyatt, J. R., Tinoco, I. 1991; 24 (5): 152-158
  • RNA Pseudoknots Accts Chem. Res Puglisi JD, Wyatt, Tinoco I Jr 1991: 152-8
  • CONFORMATION IN SOLUTION OF YEAST TRANSFER RNAASP TRANSCRIPTS DEPRIVED OF MODIFIED NUCLEOTIDES BIOCHIMIE Perret, V., Garcia, A., Puglisi, J., Grosjean, H., Ebel, J. P., Florentz, C., Giege, R. 1990; 72 (10): 735-744

    Abstract

    A synthetic gene of yeast aspartic acid tRNA with a promoter for phage T7 RNA polymerase was cloned in Escherichia coli. The in vitro transcribed tRNA(Asp) molecules are deprived of modified nucleotides and retain their aspartylation capacity. The solution conformation of these molecules was mapped with chemical structural probes and compared to that of fully modified molecules. Significant differences in reactivities were observed in Pb2+ cleavage of the RNAs and in modification of the bases with dimethyl sulphate. The most striking result concerns C56, which becomes reactive in unmodified tRNA(Asp), indicating the disruption of the C56-G19 base pair involved in the D- and T-loop interaction. The chemical data indicate that unmodified tRNA(Asp) transcripts possess a relaxed conformation compared to that of the native tRNA. This conclusion is confirmed by thermal melting experiments. Thus it can be proposed that post-transcriptional modifications of nucleotides in tRNA stabilize the biologically active conformations in these molecules.

    View details for Web of Science ID A1990ER85000006

    View details for PubMedID 2078590

  • CONFORMATION OF AN RNA PSEUDOKNOT JOURNAL OF MOLECULAR BIOLOGY Puglisi, J. D., Wyatt, J. R., Tinoco, I. 1990; 214 (2): 437-453

    Abstract

    The structure of the 5' GCGAUUUCUGACCGCUUUUUUGUCAG 3' RNA oligonucleotide was investigated using biochemical and chemical probes and nuclear magnetic resonance spectroscopy. Formation of a pseudoknot is indicated by the imino proton spectrum. Imino protons are observed consistent with formation of two helical stem regions; nuclear Overhauser enhancements between imino protons show that the two stem regions stack to form a continuous helix. In the stem regions, nucleotide conformations (3'-endo, anti) and internucleotide distances, derived from two-dimensional correlated, spectroscopy and two-dimensional nuclear Overhauser effect spectra, are characteristic of A-form geometry. The data suggest minor distortion in helical stacking at the junctions of stems and loops. The model of the pseudoknot is consistent with the structure originally proposed by Pleij et al.

    View details for Web of Science ID A1990DU03900008

    View details for PubMedID 1696318

  • RNA PSEUDOKNOTS - STABILITY AND LOOP SIZE REQUIREMENTS JOURNAL OF MOLECULAR BIOLOGY Wyatt, J. R., Puglisi, J. D., Tinoco, I. 1990; 214 (2): 455-470

    Abstract

    The effects of ionic conditions, loop size and loop sequence on the formation of pseudoknots by RNA oligonucleotides have been investigated using biochemical and biophysical methods. An oligonucleotide with the sequence 5' GCGAUUUCUGACCGCUUUUUUGUCAG 3' and oligonucleotides with variations in the sequences of the two loop regions, denoted by bold face type, were studied. Each sequence with the potential to form a pseudoknot can also form two stable hairpins. The pseudoknot structure is stabilized relative to the hairpins by addition of Mg2+. Even in the presence of Mg2+, the pseudoknots formed by the sequences investigated are only marginally more stable (1.5 to 2 kcal mol-1 in free energy at 37 degrees C) than either of the constituent hairpins. The pseudoknot structure is the stable conformation in the presence of Mg2+ when the first loop region is at least three nucleotides and the second is at least four nucleotides. Further deletion of nucleotides from the loop regions stabilizes possible hairpin structures relative to the pseudoknot and equilibria among secondary and tertiary structures result.

    View details for Web of Science ID A1990DU03900009

    View details for PubMedID 1696319

  • EXPLORING THE AMINOACYLATION FUNCTION OF TRANSFER-RNA BY MACROMOLECULAR ENGINEERING APPROACHES - INVOLVEMENT OF CONFORMATIONAL FEATURES IN THE CHARGING PROCESS OF YEAST TRANSFER RNAASP BIOCHIMIE Giege, R., Florentz, C., Garcia, A., Grosjean, H., Perret, V., Puglisi, J., THEOBALDDIETRICH, A., Ebel, J. P. 1990; 72 (6-7): 453-461

    Abstract

    This report presents the conceptual and methodological framework that presently underlies the experiments designed to decipher the structural features in tRNA important for its aminoacylation by aminoacyl-tRNA synthetases. It emphasizes the importance of conformational features in tRNA for an optimized aminoacylation. This is illustrated by selected examples on yeast tRNA(Asp). Using the phage T7 transcriptional system, a series of tRNA(Asp) variants were created in which conformational elements were modified. It is shown that aspartyl-tRNA synthetase tolerates conformational variability in tRNA(Asp) at the level of the D-loop and variable region, of the tertiary Levitt base-pair 15-48 which can be inverted and in the T-arm in which residue 49 can be excised. However, changing the anticodon region completely abolishes the aspartylation capacity of the variants. Transplanting the phenylalanine identity elements into a different tRNA(Asp) variant presenting conformational characteristics of tRNA(Phe) converts this molecule into a phenylalanine acceptor but is less efficient than wild-type tRNA(Phe). This engineered tRNA completely loses its aspartylation capacity, showing that some aspartic acid and phenylalanine identity determinants overlap. The fact that chimeric tRNA(Asp) molecules with altered anticodon regions lose their aspartylation capacity demonstrates that this region is part of the aspartic acid identity of tRNA(Asp).

    View details for Web of Science ID A1990EC08500009

    View details for PubMedID 2124148

  • SOLUTION CONFORMATION OF AN RNA HAIRPIN LOOP BIOCHEMISTRY Puglisi, J. D., Wyatt, J. R., Tinoco, I. 1990; 29 (17): 4215-4226

    Abstract

    The hairpin conformation adopted by the RNA sequence 5'GCGAUUUCUGACCGCC3' has been studied by one- and two-dimensional NMR spectroscopy. Exchangeable imino spectra in 60 mM Na+ indicate that the hairpin has a stem of six base pairs (indicated by boldface type) and a loop of three nucleotides. NOESY spectra of nonexchangeable protons confirm the formation of the stem region. The duplex has an A-conformation and contains an A.C apposition; a G.U base pair closes the loop region. The stem nucleotides have C3'-endo sugar conformations, as expected of an A-form duplex, whereas the three loop nucleotides adopt C2'-endo sugar puckers. Stacking within the loop, C8 upon the sugar of U7, stabilizes the structure. The pH dependence of both the exchangeable and nonexchangeable NMR spectra is consistent with the formation of an A+.C base pair, protonated at the N1 position of adenine. The stability of the hairpin was probed by using absorbance melting curves. The hairpin structure with the A+.C base pair is about +2 kcal/mol less stable in free energy at 37 degrees C than the hairpin formed with an A.U pair replacing the A+.C pair.

    View details for Web of Science ID A1990DB30600026

    View details for PubMedID 1694459

  • RNA FOLDING - PSEUDOKNOTS, LOOPS AND BULGES BIOESSAYS Wyatt, J. R., Puglisi, J. D., Tinoco, I. 1989; 11 (4): 100-106

    Abstract

    The three-dimensional structures adopted by RNA molecules are crucial to their biological functions. The nucleotides of an RNA molecule interact to form characteristic secondary-structure motifs. Tertiary interactions orient these secondary-structure elements with respect to each other to form the functional RNA. Here we describe the basic structural elements with special emphasis on a novel tertiary motif, the pseudoknot.

    View details for Web of Science ID A1989AY17000005

    View details for PubMedID 2695075

  • ABSORBENCY MELTING CURVES OF RNA METHODS IN ENZYMOLOGY Puglisi, J. D., Tinoco, I. 1989; 180: 304-325

    View details for Web of Science ID A1989CX43900022

    View details for PubMedID 2482421

  • Nucleic Acids from A to Z Blackwell Scientific Publications, Oxford (In Frontiers of Macromolecular Science, (T Saegusa, T Higashimura and A Abe, eds.). Tinoco I Jr, Aboul-ela F, Hardin CC, Puglisi JD, Varani G, Walker GT, Wolk S, Wyatt JR 1989: 519-24
  • A PSEUDOKNOTTED RNA OLIGONUCLEOTIDE NATURE Puglisi, J. D., Wyatt, J. R., Tinoco, I. 1988; 331 (6153): 283-286

    Abstract

    The diverse functions of RNA, which include enzymatic activities, regulatory roles in transcription and translation, are made possible by tertiary structure. Computer algorithms can predict the secondary structure of an RNA molecule using free-energy parameters for base pairing and stacking, loops and bulges. However, with the exception of transfer RNA, little is known about the structures and thermodynamics of interactions involved in the tertiary structure of RNA. Recently, it has been proposed that a novel form of RNA folding called pseudoknotting occurs at the 3' end of certain viral RNAs from plants. A pseudoknot involves intramolecular pairing of bases in a hairpin loop with a few bases outside the stem of the loop to form an additional stem and loop region (Fig. 1). If each stem contained a full helical turn, a true knot would be formed. We present evidence from single-strand specific (S1) and double-strand specific (V1) nuclease digestion, that a short RNA oligonucleotide (19 nucleotides long) adopts a stable pseudoknotted structure. The nuclease digestion and thermodynamic properties of this oligonucleotide were compared with those of oligonucleotides which form hairpin structures containing the two possible stem regions in the pseudoknot. These results show that appropriate sequences can form pseudoknots and indicate that pseudoknots are a significant type of local tertiary structure which must be considered in the folding of complex RNA molecules.

    View details for Web of Science ID A1988L714000069

    View details for PubMedID 3336440

  • Pseudoknotted RNA Oligonucleotides UCLA Symposia Series, Alan R Liss Inc, New York, NY (In Molecular Biology of RNA, T. Cech, ed.) Wyatt JR, Puglisi JD, Tinoco I Jr 1988; 94: 25-32
  • RAMAN-SPECTROSCOPIC STUDY OF LEFT-HANDED Z-RNA BIOCHEMISTRY Trulson, M. O., Cruz, P., Puglisi, J. D., Tinoco, I., Mathies, R. A. 1987; 26 (26): 8624-8630

    Abstract

    The solvent conditions that induce the formation of a left-handed Z form of poly[r(G-C)] have been extended to include 6.5 M NaBr at 35 degrees C and 3.8 M MgCl2 at room temperature. The analysis of the A----Z transition in RNA by circular dichroism (CD), 1H and 31P NMR, and Raman spectroscopy shows that two distinct forms of left-handed RNA exist. The ZR-RNA structure forms in high concentrations of NaBr and NaClO4 and exhibits a unique CD signature. ZD-RNA is found in concentrated MgCl2 and has a CD signature similar to the Z form of poly[d(G-C)]. The loss of Raman intensity of the 813-cm-1 A-form marker band in both the A----ZR-RNA and A----ZD-RNA transitions parallels the loss of intensity at 835 cm-1 in the B----Z transition of DNA. A guanine vibration that is sensitive to the glycosyl torsion angle shifts from 671 cm-1 in A-RNA to 641 cm-1 in both ZD- and ZR-RNA, similar to the B----Z transition in DNA in which this band shifts from 682 to 625 cm-1. Significant differences in the glycosyl angle and sugar pucker between Z-DNA and Z-RNA are suggested by the 16-cm-1 difference in the position of this band. The Raman evidence for structural difference between ZD- and ZR-RNA comes from two groups of bands: First, Raman intensities between 1180 and 1600 cm-1 of ZD-RNA differ from those for ZR-RNA, corroborating the CD evidence for differences in base-stacking geometry. Second, the phosphodiester stretching bands near 815 cm-1 provide evidence of differences in backbone geometry between ZD- and ZR-RNA.

    View details for Web of Science ID A1987L650500020

    View details for PubMedID 2450564

  • STABILIZATION OF Z-RNA BY CHEMICAL BROMINATION AND ITS RECOGNITION BY ANTI-Z-DNA ANTIBODIES BIOCHEMISTRY Hardin, C. C., Zarling, D. A., Puglisi, J. D., Trulson, M. O., Davis, P. W., Tinoco, I. 1987; 26 (16): 5191-5199

    Abstract

    Limited chemical bromination of poly[r(C-G)] (32% br8G, 26% br5C) results in partial modification of guanine C8 and cytosine C5, producing a mixture of A- and Z-RNA forms. The Z conformation in the brominated polynucleotide is stabilized at much lower ionic strength than in the unmodified polynucleotide. More extensive bromination of poly[r(C-G)] (greater than 49% br8G, 43% br5C) results in stabilization of a form of RNA having a Z-DNA-like (ZD) CD spectrum in low-salt, pH 7.0-7.5 buffers. Raising the ionic strength to 6 M NaBr or NaClO4 results in a transition in Br-poly[r(C-G)] to a Z-RNA (ZR) conformation as judged by CD spectroscopy. At lower ionic strength Z-DNA-like (ZD) and A-RNA conformations are also present. 1H NMR data demonstrate a 1/1 mixture of A- and Z-RNAs in 110 mM NaBr buffer at 37 degrees C. Nuclear Overhauser effect (NOE) experiments permit complete assignments of GH8, CH6, CH5, GH1', and CH1' resonances in both the A- and Z-forms. GH8----GH1' NOEs demonstrate the presence of both A- and Z-form GH8 resonances in slow exchange on the NMR time scale. The NMR results indicate that unbrominated guanine residues undergo transition to the syn conformation (Z-form). Raman scattering data are consistent with a mixture of A- and Z-RNAs in 110 mM NaCl buffer at 37 degrees C. Comparison with the spectrum of Z-DNA indicates that there may be different glycosidic torsion angles in Z-RNA and Z-DNA [Tinoco, I., Jr., Cruz, P., Davis, P., Hall, K., Hardin, C. C., Mathies, R. A., Puglisi, J. D., Trulson, M. O., Johnson, W. C., & Neilson, T. (1986) in Structure and Dynamics of RNA, pp 55-68, Plenum, New York].(ABSTRACT TRUNCATED AT 250 WORDS)

    View details for Web of Science ID A1987J557100044

    View details for PubMedID 2444254

  • RNA STRUCTURE FROM A TO Z COLD SPRING HARBOR SYMPOSIA ON QUANTITATIVE BIOLOGY Tinoco, I., Davis, P. W., Hardin, C. C., Puglisi, J. D., Walker, G. T., Wyatt, J. 1987; 52: 135-146

    View details for Web of Science ID A1987P094200017

    View details for PubMedID 2456875

  • The Left-Handed Z-Form of Double-Stranded RNA Adenine Press, New York (In Biomolecular Stereodynamics, IV) Cruz P, Hall K, Puglisi JD, Davis P, Hardin C, Trulson M, Mathies R, Tinoco, I , Jr, Johnson W Jr, Neilson T 1986: 179-200
  • Z-RNA: A Left-Handed Double Helix Plenum Press (In Structure and Dynamics of RNA) 1986; 110: 55-68